Description :
From Genome Similarity Track
Location :
Scaffold_454:7358- 8392
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_454-fgenesh-gene-0.5Calcineurin-like phosphoesterase

Sequence
1034 bases(100 bases per row)
TCGATCGAAAGTCAGCAAGAACCCGGAGATGTGTGGATGTGAGCTCGAGACTTGAGGAAACAGTGCAAAATGCTGCTGGATCGCGTCTTTAAAGTCACGG
GCTTTGATGTGCACAGCGACTGCTGCACGAGGGAACGGCATTTCGTtGTCCAGGATTCCCACCGTGATCTCGTCGCCGATATTGTACACAGTATCGCCGC
GGATGAAGCCGCcGTTGACGAGTGCATATTGAGTGCCcATTTCCTTGCGAAGCGCATCAGCGACGAGGTTGCCCATATTGCTCTCCCCTGACCTCAAAAG
GATCGTCTTGGTACTCAGCGGATACCGAGTCACGGTGCCTACGACGCGCCTAATTTCGTCCTGGTTCTCCTGTGCAGCGAGTTGTTGCAGATACTTGACA
ACAATGCGCTCACACTCGGGCTGAGGGCGAATGTGCTGGTTCACAATCATACTCCATTGCGTTGTGACTTCAAGCGGCCAATCCGGGTGCGACCCGTACT
TGTTGAGTTCGAACTCGAGCTTAGCAAGCCAGAACGCGTTCTGCCCTGATTTATGAATCAAAGTCTTGCCTTCGTACATGGTGTACGGCTCGTGGTCGTG
TCCACCGAGAATCACGTCGATCTCCGGTACTTCTCGAGCCAGTGCCTTGTCCTCGGCTATATGCACATGAGTCAATGCGATAATGAAATCGACGTTGTCT
TCGTTCTTGAGTTTGGCCACACACTTGCGCGCAGCCTCGATGTGGTCGTTGAACTGCATATTGTCGCCTGGGAAGGACGATGTCGGCGTGTCCGGCGTGA
CGACACCGAACATGCCCAATTTGAGACCGTCTTGCATCTCAATCACCTGCGTTTCAATCAAACCTTCGAGCAACTGACCCGTCGACTTGTCAATAACATT
TGAGCAGAGCCACTTGAATTTCGACTCTTTCATGCGTTTCCGCAACACGTCTTCACCAAaGTCGAACTCGTGATTGCCTAGCGTGACGAAGTCGACGCCA
ACGTGGTCCATCAGCTCAATGGCATGCGCTCTAC