Description :
From Genome Similarity Track
Location :
Scaffold_226:7357- 12340
Sequence
4983 bases(100 bases per row)
TCACTGGAAGAAGTCCCGTACTGGTGATACGGCCTAAGGCGACCGACGTAGAGCGTAGGATGCGTGCGCATCTTACGTGACAGTTCAATCGTGTATGCGT
TGCCTCTGCGGCGCAGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCAAGGTAAGTTTACCGTAGA
TAGTAGGACTAGGTCACCTTCATTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCAGCAACGGAATCT
TGCACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGAAACGTACTGTGGCAAGATCAA
TGACCTAGGTAGTAATAGCATCCTCGCTATTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGT
ACGTGATGAGTGAGAGACGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCCCTCAAACTAGAGTTACACTTTAAGAAGGTGGGTAGGCGTGGGTGGCGCA
AGCCATTCACGAAGAACGGTGTATGCTTCGTCGATGCACGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACAA
ATGGACATAACCCCGAAGGATTTCCTCAAGAACGCGGTTTGCACGTTTTGTCTGACCATCTGTTTCAGGATGGTCAGAGGTCGACATCTGAAGGCGCGTT
CCGAGTGTTTTGAACACGGATCGCCAGAATTCAGCAGTGAATCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGT
CAATAAAAACACGAGAACATGCTGATGCATTGATGGATTCAGGCACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATATCTGT
ACTCTTGTGTGGTTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACTGATTCTCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGT
GAAGGACCTGCCTTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTTGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACTGTGA
TATATGTCTTCTCTCGACCACGATGTCCACCAGTAGATGCATCGTGCTACTCATACATGATGCGCAGTCGCAGGTCACTATGGTCCGGTACGACGACACG
AGGCGTGTCGCCGGCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGAGAACCTTCTAAGGGATTG
ACGGGATGGTTGCGAGAGATGATCCATCAAACGCACCATCGCCGGATCGTACGCCTTGCGTATGTCTTCGAATAAGGTTGACGACGGGACACTCAACGTC
AACACCGCGACAGTGGTCGGACCAGTGTTGGGTTACGCAGCCGGTTCGAAATCGGTCCGGCGTGACAGAGCATCAGCGACGACATTCAGTCGTCCTGACT
TATATTTCACGGAGAAGTTATACTCCGCGAAGAACAACAGCCACCCCGCCACTCGTTGCGAGAGGTGTGGACTGCTAACGACCGTGCGTAAGGAAGCATG
GTCCGTGTAAACGATGAAGGGTCTATCGCCTAGCAGGTAGACCCTGAACTTCGCCAAAGCATACTTCATGGCAAGGGGTTCCTTGTCATGGACGGGGTAC
TTGTGCTCAGCCGGTTTCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCAC
TTGCATCGCAGACCACATGAAAGGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAATGAGCGCTGACA
ATGAGCACTCCATGCCCACTTCTCATTTTTTTTCAACAAACGAGAGAGATGAACAGTCATCTCAGTGTAATTGTGCGAGTATTTGTGCAAATACGCCGCT
AGGCCAAGGAACTTTCGAAGCCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCCGGACGCCGTGCTTACCCA
CGATACATCCAAGAAGTGGTATTTCTCTTGCAGCAAATATACACTTCTTGAGGTTGGCGTATAACTTATGCTCACGCATCAGTGTAAGAACTTTCCGAAC
GTGGAGTCGGTGGACTTCCAAATCCTTCTGTCCATCCATAGCCCGGCTATGGACGAACACGTCATCGAAAAAGCTGGGTGCAAATTCTCGCACAGATCTC
AACAGATTCGTAACACATCTGTTGAACGTAGCGGGGGCATTACTCAGCCCTTGTGGCATTACAAGACACCCCCAAAGCATACCGCTTGGGGTGCTCACTG
CTGTATAAGGAATGTCCTTTTCACTCATAAGGATCTGATAGAACCCATCCATCAGATCCATCGATGAAAAGATGGTACTTCTTGACATACCACCTATAAT
GACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGACA
TAGAAGGTAGGAGATCTATGTGGGGAATTAGGTTCTCTCGTATGGTCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATAGCTAGTACTTGTTCACGAG
GCAATGGCCATTGCTTCATAACACAATACTTTGACCCTGGTTTCAGGTCTACCTCGTGACGAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTA
TGGGAACACATCCCTGAATTCCGTCAAATCATCATAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGCTCAATCCGAGTCCTCTCA
TCAAGGACACTCTCGTCCATTGATGAGCTACTGAAAATCCTTTCGTTCTCAGCGAATACCATTGCCGACCGAATATCGGTTTACTCGTAATCCGCGACGA
GTACGCAAATCTGCTTGACTTTTCCACTACGCATATCACGCAAGAACATTTTCTGTTCGAGCGTGGGCAATCGAGTGATCTCCGAAGTTGTTTTCGGAGG
CGCGATCAGATTAAGTTTGTAAGTTCCTATACTTGATCCGTCATTGACTAGGACATTTAATGTCTATGTTGTCTCCTGGGAACTTATTTCCACAGTTGGG
TGGGGACTTATTCCCTCATTAGCCTTTTTGGGCTATCCTATCATCTGACACGAGTGGAATTGCTCCCTCGTTATCCTCTGGTGGTGGTTGCGCTACCGCG
GCCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGTGTTGCCAATCATTGGCAATCGGTTCATTTTCACTTGGGTGTCGACCGTTAGGAG
GACACCCATGCCCCAGTCCACTCGACTTATTCGGGTGGTGGGCCTTCGGCGCGACCTGCATCTCAATGCAGTCGCCGGAATCTGACTTCATGGTGTAGTG
ATCAGCCACTCCATGGCCATGTGCAGTCGTACTAAAGACCGAACCACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACAAGTTAGTGAGCGCTCC
ATGGAGTTCATCAGATGGTCATCTGGTGAACAAGTGACAGGCATATCGACTGTTTGTCGATGCCAGCTGACCTGTGGATCGTACCTTCTGAGCCACGGCA
GTCCAAGAATAACATTAAATTTGTCATCCAAGTCCAATATGTGAAGTCATCATTATATTGGACCCCCTATAGTGTATAGGTAATACCCACTACACGTTTC
ATCACTGTTACGGATGCGCCTGTTGCGAGGCGCACCATCATCCTCTTTGGAGGGATCTCGCGTTCGATACATTTGAGCTCGCTGTTGTCTAGCTATTGGC
ATCGTACAAAGTTGTTCGACGCCTCACAATCGACTAGGGCTGGAAGCGACATATTTCGTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACC
AGAAGCAGCAAACACAATGATTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCGCTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTA
CTGACCCTGACCGTTTTTTTGGCTGTCCGTTTCGTTGATGCGTCTTCGCATCAACGTCGGACCCACGCCTTGGGCCCCGCTTGGCCGCTTGGCGGTTATT
GTTTTCTGTGGTACGTGGTACCGCGCTCGGGGCACTGCTTTCACATGCATAGTGCCCTGTCTTCTGACATATATTGCATTTTGCAATTTCTTGTAATTGT
TAACACGAGAGCTCTCGTTCCTCGCGTTACAGAGGTTCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTTGACGGACGATAAGAATTCGAATTCGTGTG
AGCCTGTTTCACGCTGTAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCCAGGGTGTTGAATTCCATCCGGAACAGGTAGGTTTTGACAGGACCATCA
GTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGATTCAGTGGTTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAACGTACGAGTGTA
CGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGATCCCTAAACTCCGCTCGAGGCGGCTCAAATGTTTGCCTAAGCAGGGAATTGAAGACTTC
ATACGACCCAAAGACATATGGGTCGTGTAACTTCAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCAAAGTTCGATTGAGCAAATGCGATCTGCATTTGC
TCAACGTCGATGTGGCGAGTCTTTATGGCATCGTCTAGTTCCACGAACCATCTCAACAGAGAGTCTTCGTCGGCTCCCTTGTA