Description :
From Genome Similarity Track
Location :
Scaffold_136:73516- 78499
Sequence
4983 bases(100 bases per row)
AGAAGTCCCGTACTGGTGATAAGGCCTAAGGCGATCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTTAATCGTGTATGCGTTGCCTGTG
CGGCGCAGCACACGAAAAAACAAATGAACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACGATGTGTCAATGTAAGTTTACCGTAGAT
AGCAGGACTAGGTCACCTTCGTTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCTTTTGTCGATCCACTGCTTCTGCAGAGGAATCTT
GCACGAAACGGATAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGAAGCGCACTGTGGCAAGATCTGT
GGCCTGGAAAGTAAGAGAATCCTTGCTCTAACTTTCCTCTTCTTCATCGAAGTCGATGTGATCGACATAGGCGTCATACGTAGTGACCTCGTGGTCAGTA
CGTGATGAGTGAGCGCCGAGTTGGCGTTCGATCGAATGATTCCCCCCCCTCAAACTAGAGTTACAATCTAAGAAGGTTGGTAGGCGTGGGTGGCGCAAGC
CATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTTGCTCCAATTCAGAAACGAATG
GACGTAACCCCGAAGGATTTCCTCAAGAACACGGTTTGCACGTTCTGTCTGTTTCAGGGTGGTCAGAGATCGACATCTGAAGACGCGTTCCGAGTGTTTT
GAACACTGATCGCCAGAATTCCGCAGTGTATCGTGGGTCTCGAAGAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACA
CGAGCACATGCCAAAGCGTTGATAGATTCAGGTACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATTCAGGTATTCTTGTGTG
GGTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACGGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAATGGCGCACGAAGTGAAGGTCCTGA
CTTCACTCGTTGACATACTTCGCATGCGCGGACATACTTTCGCGCGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAGCTGTGAGATATGTCTTC
TCTCGGCCAAGATGTCCACTAGTAGATGCATCGTCATATTCGTACATGATGCGCAGTCGCAGGTCACCATGGTCCGGTACGAAGACACGAGGCGTGTCGC
CGGCAACGGCTGTATACTTCAGCCATTAAGCCATTGTGGACTGTATGTCTATCCGTGGAGGATCGATATACTGGGGGCAACCTTGTAAGGGATTGACGGG
ATGGTTGCGAGAGATGGTCAATCAAACGCACCATCGCTGGATAGTACGCCTTGCGTATGTCTCCTAGTAAGGTTGACGACGGGACACTCAACGTCAACAC
CGCGACAGTGGTCGGACCAGTGTCGGGGTGCGCAGCCGGTTCGAAATCGGGCCGGCGCGACAGAGCATCAGCGACGACATTCAGTCGTCCTGGATTGTGT
TCCACGGAGAAGCTATACTCCGCGAAGAACGACAGCCACCTCGCCATTCGTTGCGAGAGATGTGGACTGTTACGGCCGTGCGTAAGGACGCATGGTCCGT
GTATACGATGAAGGGTCTATCACCTAGTACGTAGACCCTAAAGCATACTTCATGGCAAGGAATTCCTTGTCATGGACGGGATAATTACGTTCAGCTGGTT
GCAGCTGACGTAACTGATAGTAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAATGCACATCCGATGGCAAAATCATTTGCATCGCAGACCAC
ATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAAGAGCGCTGAAAATCAGCACTCCATGCC
CACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGACCAAGGAACTTTC
GAAGTCCTTTTATGTTGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCCGGACGCTGTGCTTACCCACGATGCATCCAAGAAG
TGGTATTTCGATTGCAGCAAATATACACTTCTTGAGGTTGGCATACAACTTGTGCTCACGCATCAGTGTAAGAACCTTTCGGACGTGGAGTCGGTGGACT
TCCAAATCCGTCTGTCCATCCATAGCCCGGCTATGGACAACCACGTCATCGAAATAGATGGGTGCGAATTCTCGCACAGATCTCAACAGATTTGTTACAC
ATCTGTTGAACGTAGCAGGGGCATTACTAGCCACTCCCAAAGCATATCGCTTGGGGTACTCACTTCTGTATAAGGAATGCCCTTTTCACGCATAAGGATC
TGATAGAACCCGTCCATCATATCCATCGATGAAAAGATGGTACTCCTTGACATTACATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTA
CAGTGGCAGAATTCAACTTGTTGAAGGCATGTAGTATTCGCCATCCTCCTGTGGCCTTTCGAACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTC
CATCACATGGACCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCACGAGGCAATGGCCACTGCTTCATGACACAATACTTTGAC
CCTGGTTTCAGGTCCATCTCGTGACGAGTACCCTTATCCTTGGGTAACTCGCACGGCACTGTCTCTGGGAACACATACCCGAATTCCGTCAAATTATCGT
AGAGAGGATTTGTCTTGAGCGATTCCCGTGATTGGGATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAG
ACCCTTTCGTTCTCAGTGAACACCATAGCCGACCGAATATCGGTTACGTACTCATCTTCCGCGACGAGTACGCAAATAATCTGCTTGACTTCGCCACTAC
GCAGATTAAGCAAGAACATTTTCTGTTCTAGCGTGGGCAATTGAGTGATCTCCGAAGTCGTCTTCGGAGGCGCGATCAGATCAAGTTGGTATATTCCTAT
GCTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGGGAACTTATTCCCTCACTAGCCTCTTTGGCTATCTCATCATCTGACACGAGT
GGAATTGCTCCCTCGTTATCCTCTGGCAGTGGTTGCACTACCGCGGCCAGGTTTTCTACGTGCGATTCTCCAATCGTACTAAGATCATCGTATTGCCAAA
CATTGGCAATCGGTTCAGTTTCACTTGGGTGTTGTCCGTTTGAAGGACACCAATGCCCCAGTCCACTCGACTTATTCGGGTGGTGGGCCTTCGGCGCAAC
CTGCATCTCAATGCAGTCGGTCTCTAGCTTCATGGTGTGGTGGTCAGCCACTCCATGGCCATGTGCAGTCGTAATAACGACTGAACCACACGCGAGGCCA
TCGCACTCGCTCGTAGTACACCCACATGTTTGTGGGCGCTCCATGGCGTACATCAGATGTCCATATGATGAACAAGTGACAGGCATATCGACTGTTCGTC
GATGCCAGCTGACTTGTGGCTTGTACCTTCTGATCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCATCGTA
TTGGACTCCCTTCAGTGTATATGTAATATCCACTACACGTTTCACCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATTCTCGTTGGAGGGATC
TCTCGCTCAACATATTCGAGATCTCTTTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACAATCGACTAGGGCTCGAAGCAACATGCCTT
GTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGC
AAACTCACTTGAAGTTGCTGGATCAGTAGGGTGCTCCGCACCTATTGACCCTGACGGTTTTTGGCTTTCCGTTACGTTGTTGCATTTTCACAACAACGTC
GGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGGTTACTGTTCCCTGCAATACGTGGTACCGCTCGGGGCACTGTATTCATATGCATAGTGCCCTGT
ATTCTGACATCTATTGCATTTTTGCGATTTCTTGTAATTGTTAACTCGAGAGCTCTCGCTCCTCGCGTTAAATAGGTCCATTGGTTCTGGGCCTCCATTT
TCCTGTCGTCTCGACGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCGGCAAGATCTCATGTGCGACAAAAGCCGAGCAAGAGTGGAGTAGA
AAGCACCCGAGAAGACAATGGACGCTGGTTCCGCAACCCTTAGTGCCTCTTCTAGGGTGTTGAACTTCAATCGGAACAGGTAGGTTTTAAGAGGACCATC
AGTCAGAACCTGCATGAACAACTTAATCAACGTTTATTGGTTCGGTGGGTCGACTGTTATGCAACTAGTAAGGTGACGTATGTACTGAATGTACGAGTGT
ACGTCACATTTACCTTGCTTGATTCGAAGGAGTTTAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTT
CTAATGACCCAAGACATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTCC
TCATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACAAACCATCTCAATAGAGAGTCTTCATCGGCTCCCTTGTA