Description :
From Genome Similarity Track
Location :
Scaffold_17:735158- 743259
Sequence
8101 bases(100 bases per row)
TCGTTTGTGGCTGCTGTCGCCTTTTCGAAGAAGGACTTCTCTGGTACCTCGAGTAGTAATTGTGTGTTTTGACTCTGTATTAAAATACGTCGGGACTTGA
TCCATGTTTATAATATTTTGTCGCTGAAATTTGTGGTTTCTGATAATTTTCTGTGCGTTTTTAATAAACGCCAGACATACGTTTTTCGCGTCGCCCGGAT
GCGTCCTTGTGGTGGTATGTCGCCGTGACACAAGATTTTTCCTCTGCTTAAAGCGGTCGAACCACCCCGAAGAAGCGGCAAAAGGCTGACGTTGCGAGTC
TGTATCGTTGCTCATGGAGCGATAAATATTCAGTGCATTAAGTCGAATGTATTTGTCTTTGACCTGCAAACCCCTTGTATTTCGACTGACTTTCCAGCCG
TGAAGCTGCTTCTCGAGGTCGTGGTGCTTTGCTTTGCACCCAGCTCCCGGCATTCGGCATACCAGGCGTGTGCCGACTTGGCGGTTTTTCGATACTTGCT
GTAGTTTGTCGATGTTTTGGATCCAATCGCGTACCATGGACGGCGAAATTTTGTGCTTTTTAGAAAGCGCGTGGTATCCGCAACCGTTCTTATTTGGCTT
GTACTTACGTGCGACGTTGAATTTGAACTGAAGACTGTAACTGGCGCGCTTTTGTTTCGGCGAACGAACGTTGTGGACAGTTGCAGAAGAATGTATTTTG
AAAAATGGCGATGGAAGTTACGAGCGGTCAAACTTGGTATTCGAATAGCAAGAAAGCCTGTAAAGAGGCTGCTGAGAATGGTTGGCGCAGGCGCTTTTCC
CACAGCACCTGGTTGCATTTTAGGGGTTCGTTCTTTTAAGTAAAGCGTTCAAATCGAGGGCACCTCGCGCCATTTAAAATATATGCTCTCGTTTTTAGCT
CCTAGGCGGCTGGTGCGCGGTAAGACGGTAGTTCTATATATTACTAGTAGTATTGTCTGTTTGTCCAGCGCTAATATATTATGTGCGTGTACTACTACTA
CCAATAAGTGCAAACAAAATATGAAAGAACTTTTGAATAATACTATGGAAACCAATCTCATTAGTACTTTTTTGACGCAAGTACTACGAAGCCTAAAACA
CATTATATTATAGCCAATAAGTACGAAAGTTTCGATTCAAGCCGCAACATATGCCACCAAAGCCTACACGTTTTTTAATAGATGCTACGACGAAATATTA
CGTGTGTGCTCATCGGCGCCTTGTACTTATGCTAACTAACGCGCTCACAGGCAGCGCCCTTTGCTTCGAGAGGCGCTACGAGGCGAAATTTTAGAGCAAA
ATTAAATTTAAACGGTGCATTTAAGTGGTGTAACCACATACAGTGTGTTCAACACATAATGCGGTTTTAGCCAATTGGGGTCGCCTTCGCTGAGCCAGTA
GAACGCACGTATTTGCGTTACATTTATTAACCCTATTCATGGTCAAGAGTGCTATTTTTTCATAGTCAAGCCGAGTCACGAAGAAAGGTGCAGTCAAAGG
GATGAGAAGATATAGCACCGAACAGGTGGAGTATGGCCATGCGCGAGACAAGGTTCATGCTAACAGAACAGGCCCGTTACGGACGGATTAACGGACGGAC
GCAGACCACTTCACTGTGGGGGGATGTGTTCTACTGAAGGCTAAGGCCTTGGCCGAAGATGTACCGCTAGTTTCTGCTTGTTGAGAGTAGTCCTCCCCCA
AGTAGACGACTATGTGGTTGTGTTTCGAAATGAATTATATCAAGATTCTTTAAACTATCGTATGGATAAGCGGTACTCTGCAGGACCAGGCTTGTAGCAT
TCTTATCATTCTTCAGCACACCAGTCCTGTTGGTCAGGGCCTCCCAATATATGGCGTTTTTAATGAGAATAAAACTCCGCAATAATCTAGAGAATTGGGC
TGCTAGTACTTTTTGATTTTTACAGTATCTGTTTTAACCCCTTCAAACCGGGAGCCTGCATATGCAGCTTTTCAAAAATGCTTAGCCTGCATAATGCAGG
TTAAGCTCAAATATGACTTAAAGTTTGTATAGTTACTTTTTTTCAAATCCTCGGCTATACAAAATCTAAGTCAAAAAGAACCCTACAAGTGCAGGCTCTC
TGTACGTGTGGTAGCATAGAAGATACACATAACAAGCGACGAGACCGATAATATTTCTCTAAATTTGAATATAAGATATAAAAGTTTATGTGGTAAACAT
GAGTTTTACATTATTTTCCAAAGGTAATTTTTTCGCTCCCTCTCCAGCCACTCATTCGAGAATTCGCGCTGGAAAAGAACGGAGCCAGGCTCTCTGCATC
AAATGGTTGCTGTCCGAGGCAAGTACGTGAGCAGTCAAAACATCCCGTTTGGTGTGGCGTGGAAGGAGCTGAAGAAGCAGGGATGGACATCTGTAAGACC
GCGAGCGAAGGACTTCGATCCGAGATGGAAGTACGTTCGCCCTGGCGGACATCTTAACGGCACAAAAGGCATCGACTTTTTTCTTGGGGAGGAAGAGCTG
TTGGAGTACTACAGTGGTGGTAAGCGAGATGGTGGCGATTGCTGGCTACACAGTCTAACCAATTGTTTGTATGATGTTACAGCTTCCAAAAAGTCTTCGT
CTACCGGTTCTGGACCATTCCAGATGCCATTAGCACCTCCTGCTGATCCTGCTGCCACAACAAGATCACCACCCGTTCAAGCGGCCACCACCCAGCCCAC
GTCTCCACTTCAACCTTCTTCAGGTACTCAGCAGCCTTTGACGCGACAAACGCAAGTGAAGCGAACTCGAAAAGTGCCCAAGCCGCCTGCCACGGACAAG
CAGAAACGTCGCCGCTCATGTGAGTACCAGTTGCATATTCATGATATGATATGCAGGATATACAGGATAACTAACTAGCATTATGCATTAGCTCATGCAG
TACATCCGCCCGAAGAAGCCCGTACGCTATCCTGAATATTTCATCGACCACATGCATATTGATGCAGTCTAACGCTTGTGAATGCACTATAGTTGACGAC
GCCATATCTGATGAAGAAAAAGCGCCAGTGCCAGTAGCTGAACCCGTTACTCAAGTCGTCGCTCAACCCCCCCATCGTGTTGCCAGGTCCTCTTGAAGGT
GACGAAGAAAATATTGAATCGGGGGACGAAGGGTATTCCAGCGTTGAGTCTGTTGAAGAGAACAACGAAACGGGTATGTCTTACAATGCGATTCAGTGCG
TATGCTGCATATTCATGATACCTTATACTTATTATTCAAGATACTCCCTCCAGCGGGCTGTGACTTTTCGGAAGTATTACAAGAGCCTCGTGCTGGGGCT
TATTGATATCGCTATAGTGAACAGCTACATTGTACACAAGGCCTACCACAAGCACAAGACTTCAAAGCCGTTGACGCACGTTAAATTCATGAAGCGCCTC
CACTTGCAGCTCACCCAGCTCCAAGAAGTGGACATGTTCGACGGAAACACGTTTTGTGAGAGGGAGCAGATCGCCGGTACGTCGGGTTCTGGTGTGGCGG
GGCACGCTTCTACTCATGTAGCACAGTTGGTGGATGAATGGAGGAGCCGAGATACGCAGCCGAAGTGGCGTCAGCGTGCGTGTAAAGTTTGCTCTCTGAT
GCAGGTCGCGAAGCCCCACACGACGGCGTACTACTGCTCCGAGTGCGATGGTGATGCGCCTATCTACCTGTGTATGCGCCCGAGGCATGTAATATGCGGA
GTCTTGACAACCTGCTTTGACGTGTGGCACAAGGAATGGAGTGAAGGAAAGCTGCCACCTTCGAACCAAGAACGCCTCATCCGTATGCGGCCAGCAGCTC
CAACGAAAGGTGGTGGATCACGTAAAAGACTGAGAGATGCTGCTGATTAAGTATCATGCATATGCAGGATACCAAAGGGTGAATATGCATTTTATCATCA
GTATTTGTGTTTTTGCGAAGTAATGGCTGCAGTGAAAATTGTCTTTCTATATCTCTTGCAGGTTGAGAATCTTGTGCAACCGTCGATTCATTTTGCTTAC
TATGCAGTCCGTGAGGCCAGAGCCGGAAGCCCATGCTCAGATTATATTATAGGCTTCGTATTTGTATGAGCCATAAAAACTGAACTTTGATTGCTCGCCA
CTTGGATGGGAGAACTTTAATATATGTACGCAATTGGACAGTTTCTAAAATTCGACATACAAATATCTCTAAAATTGCAACCGTTTCTGCACCCGCCTAT
CGCTGTACTACCAGACGACCGGAAGTCAGCATCTATGTTACGGAAATGGAATGAATACTGCAGTTTAGAACCTAAACTTGCAGCCGTGTATGCACGTTAA
TATGCAGTTTGCACCGGTTATTACAACGTTCGGTTCGTCGACCATCTCTGTAACAAGTAAAAGTATACAAACACCAAGTCAAACTATCTTGCATATGCAA
TTTAAGGAAAGGAAAAATCAGCCGGTTTGAAGGGGTTAACAATCACAATATGATAGCGTCAAACAATATGATACTTACGAACCTAAGTACGAATCGCGAT
ATACGCACTCTAAACGAAATCGGGGCGTCTGCTTTATCCCCTGAGCCATTATAAGCAATAGAATGCTTAAAACAGAAGAAGTTGGGGTCGCTCAAAAATA
TTATCTCCATTTTGTGGGCGCTTGAAATGACGATACATTTAGGAGTGTTGTGAGCTCATTTTTTTCAGTTTTAGATATTCAAGTGGTTTTTAAAAGTCTT
TGCTAAAAGCAATTGAATAAGGGTACCTTTATTGTTTTTTCGAATGAAGTTTACAATAAATGTCACATTTCGGTTAAGTACGAAGATCAATTGGTTAGCT
TTAAATTCCAACACCTTTAGATGTTTTTAATCTGCTTAAGAAGGTAATACGACTTGAGCTATATTATCATTATCTATCACCGAACGATTTTTTCTTGAGC
GCCCCTCGCGCCCAGGTTTTCCCCATCAAGTAATACACAGATAAATCAGCAGGTATTGCCCAGGTAGAATACATCACTTTAAAATTACCGTTATTTATTC
TTTTGACCCTTAGCCACAAATTGGGGGATAGATTCGCAACACGTGACCGCGCCGATCCGGACGGACCGACGATGGCGCGTACACACAAGACCCCCCACAT
TAAGGCAGCGATGACGGAGAAGGTGCGCCTAGCCGAGGGAGTTCGACGGGCAGACATCGCTCGCGTGCATGATGCGCGTACGCGGTCTGAGAGGGCTCAA
TCATTAGGAACTGTGCAGAGATCTCAGCTCTTCGCCGCGGACTTAGAGGGCGATGGAGAAGAGGGAAAGTTCGCCGAGGATACCACGGAGGGGCAGGCCG
AAGGCGCGAAAGCTGCGGAAACAGCCGGGGAGGAGGCTATGAATGGCTCGGACAGTTCGGGTGTGTCGGAGGAAAATGTCGCACAGAGTTACGTGGCTGA
AGAGCCTTCGGAGCGGCATCGGCAAAGCAGGAAAAGAACCGTTTCGGACATCGAGGCTGAGGAATTGACTGAAGTGCCTGCATTTAAGGCTCAGCACAAT
TGCTGGGCCTCTTTGGAGGTGAATTTAAAGGAATACATGGAGGGTACACGTCAGCAAATCGCGGTGAATGAGGTGATTAACATCGCTTCGTCGTAACGCT
CGCCTTCGCAGCCAAGTTCGGTACCAAGGACTTCCAGACTCGGAGATACCGCTCGTACCTACCGAAATGGAGCCCTGTCAGTGCAAGTTATTCTGCCCCT
ACGGATGGTCGGAGCATGACAGGTCGACGGGTAAGCGGGCGTCACACAAGTTAAACACGACCGACTGCCCATTTCAGATGATGGCACAAGTGACCAAGCG
TCGTGACGGCATCTGGGTCATCGTGATGAAGCGAGAAGTGTACAGGCACAACAACCGGATCTCCATAAAAATTTACAGGTCGTATCCAGGTATTCGCCAG
GCTCTTGCTGATTTACTTTTGATGCTGAGATTGAGCTCTTGGTTGAAGCCAAAGCCGGCATTACAAGCGTATCCAACTATATAGGGAGAACACCAACCTT
CAAGTCACGATGAACGACGTTCATAACCTGTTGCACCGGCTGAGAAATCAAGGTAAGACTGTATTAAATGATTTGTGATGTTGAGGTTTTTCTACTGATG
TGCTCATCTTTGCCACATAAATGATGAATTGTTTGATGTTGATGATGCAGTTGATGAAATGGCTGTGAACTTCAGCAGATCGTCATCGGCAAACGTATCC
ACAGTACATGAAAGTTCTCGCGGGGATATTGGTGTTATTTCCTTCATAAGCGGCCACATGCGCGCCATGGTGGACAGCTTTCTGGAGGTGATTCAAATGG
ATTGCACACACAAGACTAACCAGTGAGTTATATGAAATGTTTGGCAGTGCGGGTTTATCCGAGATTTGAACGGGTATTGACCAGGTATTTTTCCATGCTG
GCAGGTACAACTACCAGCTTTTAACGACGGTAGCAATGGTCCAGCTTGGCAACGGCCATCCCGTGCAATACTCACTGATAAAAACGATCCGTGACTGGCA
CATGGGAAAAGGCTTCGATCACTTTAAGCGAGTTAGTGAACAATGGCGATTTGGACGAATTTTTATCGTGGGTAATGCATGCACCAAGTTTATGTCATTC
GCAAGAAGCTCCCGGAGGCTCATGGCGTACTGTAATTTTCGCGTGATCAAGTGGCTTCACGATATTATCAATAAGTCTACGAAGTTTGGAGCGTACGATG
GAGATGTTCTGGCACAAATGAAGCACCCTTTTATGAACATGACCTACTCTCGAACTATAGAAACGTATGCATCGCATCGTGATGAGTTCAAACATCTAGC
TTTGCAGAGACGGCCGCACAGAGCTTTGGGAATTTTTTTACAAGAATTGGAGTGATTGCTGTGAAATGTGGGTAATGGCGTATCGTGTGGACTTGCCTCG
CTTTGTAAATCACACAAACAACCGAGTTGAAAGTTTTCGGCAAACTCATGAGGTCGTTAAAAGGTCTATTCACGATGCAAGCCAGCCTCAAGGCTCTTCT
GGACTACCAGCACCATAAGAAAGAAGAGTACAAGTCGAAAGTCAAGACGACTGGTACTTTGCGGGACGCCTCTTATCCAGTGCAGATGAACATGGTGTTG
GGGGTGACAACGGGCTGGGTAGCCGCAGCAATCAAAACACAGCATGGTGTCGCGACAGACCCAGCCGTAGCAGACAACTACTTGTTCAAGGACAGCTCCA
CAACCAATGTCCAGTACGAGGACCACGACTACCTTCTCGAGAAGGATGACTTGACGTGCGATTCCGAGTTTTCCCAGACGATGAAGCTTCCATGTCGACA
TGCTATGGTGTACAGGAAGACGAGTGGTAATTCGCTGATCATCCCCTTCTCCAGTATTACATCCAGGTATTTCCAGGGTATGATCAGGTTTTGACCAGGT
ATTGACTAATGTTTGTCATGATGTATTGTTGGAGCTAGTGTAGGTGGTTTGGACAGAGCAGGCTTCTACCAGGGAAGCTGATCGAGGTAAGAATGGCTTT
CATGGCTAAGATATACAAGGGCAGCGTATCTACAAACGCTTCAAATCTCACTGAAGCGGAGACGTATCGACATACCTAGCAGACTTTTGGACGTCTTAGT
GGCGAACTTGTCAAGTTTTCGAACAGTGGTTTAATATCACGAAAGGTTCCGCCAAAAGGAAAATACCGCGCACCCAGTAAGAGGTTCAAGCAAGCCAAGA
CGAAAGGGAAAATCAACAACGAAAAAGCAAACTTAATCTTTGCTTCCGGCGCCGCGGTGTCCATCCTGGACGCCGTCTTTGCTCGTAAGGTTGGTTGCTA
TGTGGGTGAAACCCAACGACAAGGGTGGGTTGGTACTGTTGAGGTGGTACAGCACGAAGGGAAGTAATAAGATTAACACCACCTTGGCTGGAGCCATGGT
GTGCTTCTTCGACGTGTGGGTCGGCGAGATATCGGGTCAAGACGCGATTCTCGGTATGAACTTCATGGTATCAAAGAGGATTCGCTTGGATTTGGTCGAC
GAGACACTTTGCTTACCCGACGAGGTCCGCATCCAGTGTCAAGGCGATGCCCGCTGTATGTCGAATACATTCGCCCGGTCAGTTTGGATGGGTTCAAGAA
A