Description :
From Genome Similarity Track
Location :
Scaffold_676:7350- 8528
Sequence
1178 bases(100 bases per row)
AAAGGAATGCGAAGTCAGGCTATCACTCACACCTGAATTACCCATGACTCGCTCGAGAACGCGATTCACGTAGCTGTGGATACCGGGCGAGGCGTCGACC
GTTTTCGGCTGTCCACCAGACTTTGGTGCGTCTTGACGATGGTCAATCAAGTCAATCAGAGGTGCAGTGGGCGTCTGAGATGGTAGGGAAGGTCCCTGCT
GTTCTGGAAGCTGGTTGAGAAGTGCTGCTGGTGGTGATGAGTGCGTGATTAACGCAAGGACAGCGGCAAGCAACGGACACGTGGTAAGGTCGGAGTCAGG
GAAGAGCGCTAAGCCTTGCTCCTCGAAAGTCTTGACCCGGATGAGCCGAGCGAAAAAGATATCGCCGGAACCAATTGCAAGATTTGTTTTGCGGAGAAGC
GTCAGGTCCGACGCGCGCCCGAAGAGGTACCAGAGTAAGCATAAGAGCGCCACATCTTGGTAGCGCTGGCGCAAGTTGCAGTTGAATACAAGTATTCGGT
CATCTGCTTAAGAGATTTCTTCGTGCCGTCTGGGGCCTTGTTAACAAACGTTCCTGTTTTACGCTTCATGCAGTAGCGTTCCAACACTTAATCTTTCTTA
AGCAGGTTCTTTTCAGCTGAAACGCGATTCTCGGGAAACTGGTCGAGCAACCAGCTCTTTGCCCGTCGGTAGTACTGCATCACCGAGTGTCAAGCTAGAA
GCTGTCCCTTGCGGCCTTCCTTGAAGGCGAGATATTTGCCAAATTTACCTTCTTTAACCAGCGCGGCCGTAACGCGTATCATAGACCCCTCCAAGTATTC
CCACGTCACATCTTCGTATTTTAAAAACGCTACAAACGAGCGTGCTGCGCTTTTCTGAGCGCATTTCGTGTTGGCGGGCACAAAATCGCTGAGGCTCATA
CTGAGTCGGAAATGTCCGAGCTTTCACGTTATTCGATAAAGATGCTAATGACTTACAGTTTGTAAAAGGATATCAATAGCTGGATCGCTCCCTCCAACCC
GATATGTCGGAGATGCTGTCTATTTACACAGCACCTTTCGGATTGGACAGATATCTGCAGCAACTCTGCATTTATTCGTTTAAAATTATCAAGGACGTTC
AGAACACACTTCATTGGCTAATACCGTGAGTAGTAACGTCAAGTATGGTCGGAGAATTGATGATATTCATCCATACCA