Description :
From Genome Similarity Track
Location :
Scaffold_2988:735- 2694
Sequence
1959 bases(100 bases per row)
TCGGTGGATCCGAGCTCAACACGCATTCGTAGAGCTGAGGAACAGGATCGCAACCACACCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTA
ATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAAGGGATCTGTCATCCAGTCACCTTCGTTAACCGGACACTGAATCCAA
ATGAACCGAACTACGGAGCGGTGGAGAAGGAGATACTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCT
GACGCGACACTCTACGCTAGCTTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCCTTACGCTCGCCTTATACACTGGGAGAT
TGTGAAATGTTCCAAAGGGGAAGACGAGATCCTGGGAGTCTTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCC
TAAGAAAGAGCCCAAACGCCGGATCCAGACCCTGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGA
CGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGCCAGATCCACTTACGCAGAAGGTCTCATTGTCAATGAGG
CGGAATATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGT
GCGAGGCGAGATTGGCTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGATGGTTAAATCACGAGTTGGTGCATGTC
AAGCGAGATTGGAATGCCAGTGCAGACAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGATCTCG
TTACATTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCAGGAAAAGAACAGTACAGGTGATAACCGTCACTAGGTCCAGAGGAAGGATTGGATCCAG
CCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGTATTGAGCGGATCCTCATAGCACAAAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTAT
CTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACTAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATT
GCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATGCTAG
CCTGGAAGGCGGATATCAGGGTATTGGTCGGACCTACCAGCGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGT
GAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGG
ATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTC
TAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGCGCCAGGCTTTATG
TCTGATTTCTTTCGAGCATTCAACCAGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGC
AGACAATCACGAGAGCTTATCAGGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGA