Description :
From Genome Similarity Track
Location :
Scaffold_2504:735- 2343
Sequence
1608 bases(100 bases per row)
AGACCAAATAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGAC
AGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCCAGGGTGGAGCGACGGGCGAAGTTGCCCGAGGCTCCCGAGTCA
ATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACACACTCTTCTCGTAAGAGAGCTCAGCTCTCT
TCGGGGCTGAGCCCCGTTGTCCTCTACCTCTTCGAGGCACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAGTTGCCGTTTCCC
GGCGATGACCCGGAGGGTTGGCTCGCCGGAGCCTCGCGCTTCTTGCGCAGAGGGCAATAGGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGC
GGATGTTGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGACTCTGGACCGCTCGAAGAGCTTGCGCTACC
AGCGCTCCAACCAGGTCGCGCCGACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCACCGCCTCTCAAAAGAGTTAGGGTGTACACGGAACACTTCCG
TTCGAGCTGCGCTCACACAAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCAGGAAGAGAATCCCCCGCCATTCCGGCGATAAGAGTTCTCAACTC
TTGGATATAGTCCAAAAAATCCTTCTTACCCTGGCAAGTAGCAAGAAACTTTGACCGGATACGGTACGCATGATTAGGCGGCGCGAACACGCGCGAAAGG
AGTTGCTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGCGACCTCCAATCCTGGAGATAGCCA
GTGCCACGCGCTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGTCATCTCGACCTCACGGGTCCAGAGAAGGAGATTTTCTCCATCCTTCCCCTCGAA
GGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACATGCTCC
AAGAGCGCGTTCTCGTAGCGGGAGAGCGATTCCAGCCTGTAAAGGACCGCCTCTGGTCCTTGCGCTGCAAGGTGAGCCAAAACGGGGGGCCAAGCAAGGA
CATAAGCTTATTAAAGCGCGTCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGGAGCGA
GATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATC
CAAAGGACACTTACAGCCCAAGACCAGAGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGATTTATTTACTATTATTGCGGCCAAGC
CGCCTAGG