Description :
From Genome Similarity Track
Location :
scaffold_467:7342- 9028
Transcript NameFunction/comments
Pl_104618cryptochrome, putative
Pl_104619hypothetical protein PHYSODRAFT_492835

Sequence
1686 bases(100 bases per row)
ACTGCTATGCATGCGGTACACCGAACTTCGACTCACAGGAACAGAATCCAGGCTGTAAGCAGATCGAGTGGCGGCTTCTTGACGAAGAACATGTACTCAA
ACCAGAGCATGACCTAAAAGAACAAACTAGCCTGACTGATGCAGACGAGAAACTCGCCATGCGCCAATTACAGTGCTGGAAGGACGGAAAGACCGGCTTC
CCATGGATCGACGCTGTCATGCGGCAGATTAACCAGGAAGGTTGGACGCACCATGCTGGGCGCCATGCAGTAGCTTGCTTTCTGACACGCGGAGTGCTCT
ACATCTCGTGGTTGCGAGGGGCTGCATACTTTCAAGAGAAGATGATCGATTTGGACTGGGCGATCAATGTTGGCAATTGGCTCTGGGTGAGCGCGAGCTG
CTTTTTCTCGAACTATCGTCGTGTGGCATCTCCATCCATGTTTCCACAGCGATGGGATCCACAAGGTCATTTCATCCGCAAGTACATTCCGGCACTCAGT
AAAATGCCTGACAGGTATGTACACGAGCCGTGGAAGGCGCCACTAAAAGTGCAGCGCGATGCCGGGTGCCTCATCGGCAAACACTATCCTTTTCCCATCG
TCGATAGCAAGCTGGCCATGTCGCGGTGTATAGCTGGTATGAGTCAAGCGTACTCCGACAGCGAAACGGAGTCCACAACATCTTCCGCTACGAGCACACG
CACGCAGTCAGATGACACAGAGGCAGAAAGTTCGTCGCCCTGGAGTGCTGATGACATGTGCTACAATTACAAAGGTAGTGCATCAAGATCACAGCCGTAG
TGAGATCCGCTTCAACCTAGCGTGACGAAACAAATATGGTTGTGGACACTAGCAATATTGTCCTCTTCTCCTCATTCACTAGCAAAATAAATTATCTCCT
TGCTCGACAGTTTCGGTCTTGCAATGCTCGACTCGACTGCTCAAATCGCTATAACAATCACCCTGCATGGACCTGTATGAGGCCTGCGAGAATGGCAATG
AGGAGCGAGTAGTCGAATTGCTGGTGCTAGGACACGACACTGGTCAGATTTCATCTCCAGCATCGCAACTGTGGGTTCGAGGTATCGCTGGGAGAACAGC
ACTGCTAGCTGCGTGTATGGGTGGACAAGCGAGTGTCGTACGTTTACTTCTGGGTGAGAAATGCATTGTACACTTTACAAGCCGCTCGGAAGATGAAGTG
TTGAAACTACTGAAGCCGCTAGTGAGCAACTTTCAACAAAATCTAGGTTCAGATGAAAGTGGTGCGCTGTTTAAGGTGTCAATGGTGATGAAAGATTGTG
ATATGGTGCCGGTGCCAATGGCCGAAATACAACTTCCACCTCAGTGGGCCATCCCACCAAGTGAATTGCTCGAGGGCAAGCGACACGTTGATCACTTTGG
CAATACTCCATTGCAGTGCGTGAGTTGCTTTGGTTGTGGCTCAAACGTAAAGCACATCGACGATGGACTGGATATCACCAAGCAGCTTCTAATCCACGGA
GACCAACCCAATTTACCAAAGAGAAGCAACAGGTGGACACCGCTGCATTGGGGTGCGTACAATGGGAATCACGAGCAGATTGCGATGTTGTTAGACCCGG
TGTTGCATGTTGGAAACGGCACACAGCGTTTTGCCAGAACACAGTTCGCTATTCCACTTCTGATCGATACGGACGACCTGTTTGCG