Description :
From Genome Similarity Track
Location :
Scaffold_17:734037- 738028
Transcript NameFunction/comments
Phyca_LT1534533823serine protease V8

Sequence
3991 bases(100 bases per row)
gctccgctttctctgattctcggacctcgcgtccttagtgtaggccgacctctctacgaagattcaccagccgcggcgcatcgagcgccttcgtcaacaa
gtcagccggcatgtgctcactctcgcggtactctggcgttaatagccccttctgggtataacacccgacgaacttgatgcggacgtcaatgtgcttcgcc
tttgccgacgcgctctctccatccagctgcttcagtgcagcctggttatccactctgagcgacattggcttcctgtacgccacgccaagctcttccattc
actgcctaagcccaagcagttctgcagccattatcgaggccgcggtgtactccgcttccattgtggacagcgagacacctccttgtttcttgcacatcca
gctcacggccatatccacggtggcaaacccgccggtaacagacttcctgtcagtcttgtcagccgcgaaatctgcgtcgctgtaggccaccatctccagg
tcctcgtcagtgcctttattccctctcattcgaagcttgaggctcttggttcctcccaagtacctcaagattcgcttagcgagcttccatctcccagtgt
cgggctatgagtccgtcgcgacgccttatgcaccgcaaacatgatgtcgggtcgcgtacagcgcgctaccgacatcaaactacccaccaaagactggaac
ctcctcacggtcacgctaccgtctcctcctgaaaccggcagcacatcggttgcatccgccccgttccattcggctcctattggcgtccgtaccccattcg
ccatctccatcccgtactcacgcaacatgtcagttatcatcacctcctggtccagatcataaccgtcaccgtcgtcgtattcgacacgcatgccgaggaa
cttgctgacctcaccaaggtccttcactgccagcccagatagctcaccaaagaacccgtctacagcatcttgctgcgttccagtgactagaagatcatcc
acatatactcctacaacgaccaaagctcattccttgagtctgcagtacacacacatgtccgtaaggctctgcttgaaccccacgtccacgagtttttgat
gcaacagtttgccccacagtctcccggcctgcttcaacccgtacagggccttctgaagctccagagccagctcgccgtcgtcctcgacacccagcatctg
cagtacatcgaccgggaccgacatgccctgcggcaagtgagtgaagatgtccagatcctcctccttgtccgccttcacgtacgcgttgtgtacgtcaccg
tgcttggctttgactcgccacttcctggccagtgccaaaatcaccttcacactactcatttctattactgcagcgaacgtcagcccatagttcacaccga
tctcttgctcgtttccacacgccactagccgcgccttgaagcgctcgattcctccaccagcgtctagctttgttttgaacacccacttagtatgcagtaa
tttttcccctctgggtttccgcacgatcttccagactccgttcgcttcgagagcgctcagctcctcggcgatagccttcagccagtcacccttgcgctcg
ctgcgcatagcttctccgaagttcttcgggtccgcgtcgagaacgttgttaaccacgtcaaccgctagctcctcctgtcctgcaggttcagccgcctcct
tgcccgactcgcgagccaccgaccgcgttatgtgacgctcgcgctgccaggtcttcttcctggacttccttttcgcctttctcgctcccgatcgactctc
ttcttcgcccccagttctcacagcggaacctgcctcgccgtcctgctcttgctcctcatcatcctgcaagtagaggcgctgaatcttgacgttctggtcc
ttgtcaagagtctcaatatttttgacatgttgggtggttactacgatgcgatccttgggcaagtagaccctgtaccctttcgtttcttcgccaatcccga
ctatcatgccctgctgcgcccgttgcgagaagttcttgttgcgcggatccctgtacacggtacagggggagccgaacactacaatctctccgagagacgg
cgtctgcttcgtcagcaccttgagtggagatgctcttcctggattggagttgcttggcgacctgttgagtatgtaggctgcgtattgtacggcatctccc
cagaagttcagaggcagcccacatgcgaaaatcatgcacctcgccatgtccataatggttcggtgcatgcgttctgcctttccgttgctagcctggttgt
tggcctcactattctgccgagtcaccccggtcctcttgcagaacagatctacgttctggtactccgccccggagtcggtccgtagcacgtggattctgca
atccaatcgcttctcgaagaacactaagaaatgctcaaactgctttgcggcagcgtccttcgtccgggccagaaacacacggcaataattcgacttatgc
tccacgaagttgatcatgtatctgttgttctgtctgtctttcggcgtcattgggcccttcaggtccgagcatatgacgcccccgacgcgatcaataggcg
agtggctgcccgtatccttgcttgactggcgattcttcgactgcttcccttgcgcacaggtaagacagttcacccgcttacgatctgtaagcctgatccc
cgagctgatatcccttgccaaacgctccactgcgtcataattcaggtgtccaagtcggcggtgaaattccaccagcgtgccagtctgcacgtcaccgtcc
gagtcttcatccgacttgttggcctcttcctcgagagctgccatgatcacctctgctggaggtcgcaacctcctctgcacggttcctggtactaccagta
catccctgcgtatcttgacatcgaaggcaacttgtccaccgtctctggcggccaccacccgatgtccacctctccgcgccagcacgaaacctttctggtc
caactggccgtacgagatcaggttgtgaataacacccttcgcaaagtacacgtccgtcagcttgacggtctgcaccgcgccgcacgcggtgacctgcagc
gtcacgctgcccttcttactgatgtggagagggtctccgttcggctgaacacactggtcagcgcactcctccacatcctctagccacgacgcatcgttca
ctagatgtctactggaacccgagtctaggacccaaaagtcgtcggtctcgtccaactcatcttcacccactgccaaagtcacgtctggccttcctgctcc
cacgccggcgcgttctgggcacatgggccgtatgtgtccgaccttcccacactcgtagcacttcctagtctccttcctcttttccctgacggtgttcacg
acttcccgtccgaggttctttccttttccgctctcgagctcccaggcctgagcgaagtgcgcaagctcttccgcatgcgcgagatagtccgtcctggtgc
tatcaaccttggccatcaacaccattcgtaagtccgcggacgcatactggacgatgttgttgagaacgagatactccgcactgccgccactggcctccga
cactgcgaccaagtacatttaatgctcgggccacgtgcgtttcgggtccttgggcatcgtgaagagcttcacagcctgcgcaggtgtgatgttggtcttg
aaagtctcaagcatcctctccatcacgtatcccagcgacgggtactgcccccaccacgactcaatctgcttgttgaagtatctctcagcggtgcctgaca
agtagtggcccaagagatccaccttgacatcctcaggccaaagaaacctgcacgccgactgtgcaatgttcacttgacgctcaaagcgtttaccccactc
aaggaatcccgatcccaggcccacgtacagctccttgccgtcgaaaggacggatcgccaacttcttctgccgcgcgtcagggaagcgaact