Description :
From Genome Similarity Track
Location :
Scaffold_8:734000- 740418
Sequence
6418 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACCAATGGATACATACATTTACGACCACCACGATGGGTGGTCAATGCACATTTATTATTCCTATTGGCTGAAAGC
AGCATCTTTCAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGCTTAGAATATTACATTTAGAGGAAGTCAG
AAACATAAAACAAAAATAGCAGTTCTCATCTTTTACCAAAACACGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTA
ACTCAAGTAAATAAAACCTACGCTTCCTCATACACGTACGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCATTACACCTGGTACCACTTTGT
AGTCCGTCTAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCTCC
CCTTCGCGTGCAACATGAGTTGCACGCGCTGACTGCCTTCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTTATTGGAGATGCGG
CTGTAGCTGCAATGCTGCGCACACTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTATCAC
GGTGGCGTCGGGGACGACACCGCGCGAGCAATCGTTGAAGCTAAACGTGAGCAACTATGCCGGAAGATAGGGCGGGCCTCTCCTCCGTTGGCTTGTCGAA
CTCGACACTGCCATCTCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGAAGTTGGGCGTATG
GACGCCGACTTTCTGATCCTACGTGCTTCAGCACGTATGAGGGTTTCAAGGAGGAGCTCAGACAAGCGTTTGCGCCCCCGCAAAATGAGTTTCGGTCGAG
GGCAGAGTTCCTCGACCTACAGCAGGGTAAGCATGATATCCATGCTTACACGCAGAGAGCACGGTACTTGGTCTCGAACATTGTGACCGACCCGATAGAC
GAGGTGACCAAGGTCGTCACGTTCATGAAGGGTCTGAGAGATGGGCCTGTAAAGACCTATCTCTTCCGTGAGTACCCAGGTACTCTCGAAGCTGCGATTA
CTCTTGCGATACAGGAGGAGTTTAGTCTGAGGCAGGCTAAACTACATGCGAATGCGCCGAGGCTGCAACCGCCTCCGTTCGCGATAGCGGGAGGTCCGGA
ACCAATGGACCTCTCGAATGCAACGGCTATTGGTTATCAACAGCAACAAGGAAGTAATGTATGATGCTTCCGTTGCGAAAGGATCGGTCACTATGCCCGA
GAGTGCACGGCACCCGTGCACCGAGATGGTGGTCGACGTGGCGATGCCGGGCATCGTCGCGGACAAACAAAAAACGCTGGAACCCAGTAGGCGCGGGGCG
CCCTACTGGTGAAGCAGTCACGCATGTCCAACTCGGACATGCGACACTGAGGACTGCAGCCCCCAGTGAGGACCCTTCTCACTGCAAAATGCATGATGAC
AAACCGAACCTTGTCATCTTGAACGTGTCTTCGAAGAGAGAGAGCAACTCTCTTCGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTCGACTGC
GAAGTCTATCAAGGCTTGACTTCGAGGATTCAAAGATACATCGAAGTATGCTGGAGGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCAT
GGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGAAGATAAGTTTGACATTGTATTGGGCATGCCGTGG
TTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGC
ACGCACCAAACAGGTGCGCGCGACTCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCACGAGCACGCGCGGAAGAGCAGCA
AGCGTCGGCTTCGCCGCCGACGGCTGAAGGAGAGAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGACCTCAAGG
GGCACGGATGACGCAGGTGAGTCACACGCCTCAGCCGTGGAGGCCGACGCGAATCTGATTGGATCAGTTTTGGCCAATAACAAAAGCCAAGTTGACGAAA
CGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTACGTAATGGGGGTCTCCGCCAATGGTTGGCG
TCGAGGTACTAAAGTCGCGAAGGTTCCGAGAACCGGCGCTGCGAAAAGAAGTTTCGCGTCGACTCCCGGAGTCGACGCACCCTTTGTAACCAAGGGCTCC
GCTAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTG
CATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCTGGCGACCAAGCCGGGCTTGAAGCCGCTCGCCCGCGGGATGAACCCACCGGCGGTACTGAAGA
AGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAAAGTCATGCGGAGCCGGGCTCCGCAGGACAAGAAGACGGCGCATGCGAAGGTCGCTACAAGGA
ATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCG
CTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTACAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGTACATATG
CATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAG
ACTAAGAAGGAGCGCTTTGAGAAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACAAGATTCTACGGAGGCATGCGGACGTGCTTCATGAAGAGA
TCCCTGCGGAACTTCCGCAGGACAAGGACATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGA
ACAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAG
AAGCCACAGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGACGCGACGATACCGGCGCAGACACCTATACCGCGAAAAGATGTAATCATCGA
TTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGAGCTACGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGT
ACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGTCTGATGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGG
TGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGAGGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAA
GCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAAG
AACGGCTTCCGCCCTGACCCTGAGAAGGTCAGAGTGGCCGACGCCGTCGAGCGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAG
TACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCCGGCCTTCGATG
CAGTCAAGCGAGGCTTGACTGAGGCGCCGATCTTGGCGGTAGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATG
TGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCGGCTGAGCGCAACTACCGGGTACATGACAAGG
AACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGCTGCGGACGGC
TGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTG
GTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACAGATGCCGACGTCGATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGT
TGGACCACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGTTGCCGAA
GCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTGCTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGAC
CATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCAGGGCCGTGAATACCTTCTTCTCACGCGAGACTTCTACTGGG
CCCACCAGTATAAATGCGTGCGCCAGTTAGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGTCTGCGTCTTTCGCGCAGGCTCCCTTGCAGTCACTGCC
GACTCCGTTGGAGTGTTGGCCGTCCATGTCTTTGGACTTCGTGTTCGGTCTGACCCGCGCTTCACTGCGCATCTCTGGCAAGAATCCGCAGATGGACGGG
CAGACCGAGCGCGTGAACCGCGTGCTCGTTGACGTTCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGTTCGCCA
TCAACAACTCGGTGCATGCCTCGACTGGGCATACACCGTTCTACGTGAATGCCATGAGGCACCCACGCCTCCGGAGTCTACACGGGATGGTGGCTCCTTC
CTTAAGTGGGGGAGCATCTCCGACTGCAACGCGGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCAACGACACGAAGTAAAGCCGAGAAC
TGCGCGTCTGTGCAGGGCACAGACGCCGACAAGCGCACGAAGAACGTGTCTGTGCGAGGCACAGACACCAAGAAGAAGAAGAAGAACGGGTCTGTGCAGG
GCACAGACTCCGCGAAGACGAACGCGGTGGCCGGGCCTACTGCTGGAAACGAGCTGAACTCGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACA
AGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGATCGACAGAAGCTGAACGCAGACAACGTTGGCAGGGGCAACACAAATGATTTCAAG
AAGGTTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACATGCCGTTTTCGACTTCGGGGCGAGCAAGCTCGCTCCGATCTTCATCGGGCCGTTCA
CTGTGCTGGTACGGCACGGAAACGCCTACACACTGGACAAACCGTCTAGTATGCGCCCCCATCTGACGTTCAACGTTGGACGGCTGAAGCCATACCTGCA
GTACGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCATCATCCTCGCCAGCGCGAAGTCGCGCTGGAGCAGCGGGTCGAGCTAAT
ATTCCAGCTCGGCCGGAACGATCGAGGCGGCCTGGGAGGCCGTCGCAACCTGAAGATACTTCAGAGCGCCGAACCCAGCGCTCTGGTACTACTCCACGAC
CGGAACTCGGTCGTGGGGAGACGCGAGATCAGGGTCAACACCAAGTTGACCACACACGAGGCGTGTTTCCACCACCACCGCCGCCAATTCGTGACGCACA
CGAGTTGAGCGGACTGTTGGTCACAGTATCCCGAGAACGAACAGACAACCGGTTGGTTTTCGTATCCGTTGGAGAGGATTCCCTTCCAACCAAGATACAT
GGGAGCCGCGGAACGTCTTGCTCGAAGACGTCCCGGACATGGTGAGGGCGTACGAAGCCCACCTTGCGCTACACGCTGGAAAGTAATACGAGCGCTGTTG
TTAACAACATCGCCCGAA