Description :
From Genome Similarity Track
Location :
Scaffold_22:7340- 9386
Sequence
2046 bases(100 bases per row)
tcgtcgatgggatcactgagggcgatgacaccctcagtgcgaagactaagaagcagcgctacgaggagcagagttgggactcgttgaagtcgagtcccta
ctatgaggtgctgcgggagtacaaggatgtactcccggatgagattccttcggagcttccgaaggacaagggcgtacagcacgagattgatctcgtgccg
ggcacgaaatattgcgttacacggcagtggccactgccgcgtgaacaagttcaagcgatcgacgacttcttcgagagtcgtcgtcttgcaggtcaagtgc
gggaatcaaagtccccgcacagtgctccaatgttctgtgtcaagaaggcacagggcggctggcgcatcgttcatgcgtacaacaagttgaacgatgcgac
gataccggcgcagacgccgataccgcgaaaagatgttatcatcgattcgatggccttgagcactatcttcagtgctctagatctgcgtgatggattctat
caaatcctcatgcgtgagagggacatccctctcacagcggtaagcactcccagcggtatgctgtgggagtggctcgtcatgccgcagggacttaagaatg
cccctgcgacgttcaatagatgtgtgactcatctattgcgctcggtgcgcgacttcgcaccgagctacttcgacgacgtgttcgtccacagccgggctgt
gaacgggaagacggacattgagatgcacaaggtgcatctccggaagctgctagagcttatgaggaagcataagctctatgcgaacctgaagaagtgtatc
ttcggggcgaacgagatacccgtgctggggtgtctcgtcgggaaggacggcgtgcgccctgacccagagaaggtcagagtgatcaatgaatggcccacgc
catccaatgtgaaggaactgaggcagttccttgggcttgccacgtacttgtgcaagtacgtggagaactacgcgggcaagattcgcccgctgtcacagct
tcttaagaaggaagctgagtggatttggacgaccgaatgccagggggcgttcgatgcagtcaagcagggcttgactgaggctccgatcttggccgtcgcc
gaccaagatcgtccattccacgtagtgtgtgatgcatccgatttcgcgatcggatgtgcattgatgcaacatgatcacgaggggcgtgatcgtgtggtct
actaccagtcgcgtcagctgaagccagctgagcgtaactatcccgtgcatgacaaggagctccttgccatgaagtatgcactcgcaaagttccgagtgta
tctacttgggagtagaccgttcgtggtctacaccgaccacgcatcactgcgtacggcgattaagtcgccgcacatctcgcaacgtatggcgagatggttg
tccttcttcgcggagtacaacttccgggtggagtacaaacccggaagactcaatgtagtggccgacgcgttatcgcgtcgacctgattatacggagacgg
tcgacgccaacagtgttggcgtcgtgaggacaagtgtgccgtcgtcaacgttgattgacgacgtgaaggacgcgtatgcaagggatgcagacgcgaagga
gctgctggagttcctcgcagcaccttccgacgaggcacgtcggaagctaactcctcaccttcgagctcgtgtacaccgctatcgtgtacacgaagggcta
ctgctatacagtgcagtagacgacaacgcggatcgcattgtcgttccgaatgatcatgatctgcggctgcggatcatgttcgagtaccacgatgccccta
cggcagggcatccgggtcgtgagaagacatacactcttctcacacgtgacttctactggcaccaccagtacaagtgggtacgcaagtacgttcgtgcttg
cgaggtttgccagcgcgtgaagcctgcgccgtttacgcaggctcctcttcaatcacttccgactccgtcggagtgttggcagtccatgtccatggacttt
gtcttcggtcttccgcccgacaacaagcggaggacaggcatcgttg