Description :
From Genome Similarity Track
Location :
Scaffold_168:734- 6453
Transcript NameFunction/comments
Hyaar_Emoy2811745nuclear transcription factor Y subunit putative
Hyaar_Emoy2811746solute carrier family 35 member E1, variant
Hyaar_Emoy2811747down syndrome critical region protein 3

Sequence
5719 bases(100 bases per row)
CTCTCTTGCCTTGATGCTGCTTCTAATGACCAGCCAAGTAAACCACTGGAGCCCAAGATCAAGCCTTCCTCCCGACCATGTCCAGTGACGGAGACGCCAC
CACCACCACCAATAACAATAACAGCAGCAGCAGTAATGCCAACAACGTGAACCTCCAGATGCAGCTCCAGCTCCAGAACCAACGCGCCCAGATGCAGCAG
CAGCAACTGGCGCTCCACGCGTTCTGGCAGCACCAGATCCAAGACATTTCGCAGATCGATCCCAACGCTTTTGACTTCAAGACGCACCAGCTGCCCCTCG
CGCGGATCAAGAAGATCATGAAGACGGACGAGGACGTGCGGATGATTAGCGCTGAGGCGCCCGTGCTGTTTGCCAAGGCCTGTGAGATGTTCATCCTCGA
GCTGAGTCTCCGAGCGTGGATCCACACGGAAGAGAACAAACGCCGTACGTTGCAGCGCAATGATATTGCCATGGCGATCACCAAGACGGACGTGTTTGAC
TTTCTTATTGATATTGTCCCACGGGATGACATCAAGCCGGCGAAGAAGGTGCGTCCACGAGAGAGAGAGAGAGAGAGAAGGTGGTGGGTTGGTGCTGCTT
AGTTGCTGAGCTTATTCTGTGATGTGCTTTTTAATGGTGCGGTGGGGCCGGTAGGGACCCGTGGATCCTCAAGCAGTGTACCAGCAGCAGCTGCAGCAGC
AACAAGCTGCAATGCTGCAACAATTGTTGCAGACGCAACAGAGCGGGGCCATGGCTGGTGGCATGCAATGGCCGGCTCAACACTTGCAGCAGCAGATGTT
GCAGCAGTACCAGCGGATGCAGAACATGCAGCAGAACGCAACGGAAGCTACGGGTGGACCCTCGACGCCGTCGAATGGAGTGCTGCCGAACTTGTCGCCG
TCAGAAAGTGATGCTGCTGGCCAGTCCGAAGCTAATACGACTCCTGGAGAGTCGACGTCGACGTCTGATCAGCTCTCACTGAACGAACGGAGCGTCGACG
TATAAAAACTCCATTCGCCTGCACAGTACAGCCAGCATCGAAGTGTGGCATGTTTTTGATTGAATGAATGACTCGTTGTTTCGAAAAGGCGTTGAATGTA
TCTCTCCCCTCTTGTTTCGGGTTTTCACTCACTCACGTACTCCTGACCAACTATAATCTATATCGTCTTGCAAATACAACTAACGAGATGTAGAAGCACA
ACTTACTCGGACGTTTTAACTGTAAAAGGTAGCGGCAGCATCTTTGATCCCTTTTCGGTAACCTTAATGAGCTGGTAGCCCGCCACACCGCTAATCTGTA
GTAAACAAACATCACCAATGCAATGCCGTCACATCGGAGTCCTTCATCAAACGCGGATATATATACACGTCACATACCGCGAGTGCCATGCCAAGAACCG
ACTGGAATGTAACTGGGTTGCCAAAGTACAGCACGGCGCTAAGGATGATGACCACTCGCTTCATTGTACTCATGATGGAGAATGTGAGCTCCGTGACCTC
GCCCAGCACCCACGACGAGCAGAAACTCCCGACAAAGTGCATCATGCTGCACAGCAGCACCTTGCCAAACGGAAAACTCGCGACAAAATTGTCTTGGTGA
GCTCGCGCCGACTTGAGTACGAATGGTGCGTTGATCGCAAACGACACAAACGCACTGTAAAAGTGCAGCTGTAGAAGGCACGCATGTAAGACAGATAATC
TCACAACTGTCCCAATACCATCAACAGGCACGTACGTTCGCGGTATCGACCACAATCCGGCGACGCAACAGAAACTTGGCATACATACTCTGCATGACAC
CCAACAACGCAGACGTTACAGCAAACACCGTGCCCGAGAAGGCCAGGTCCTACACCAACACGACAAAACAGAAAACATCCGACACATTCATCAGTTGTTG
CGAGCACCCTCCAAGCTACTGCAATGAAGCTTACATTTATGCCCATTTCCGACACGGACGCCATGACAACACCGAAGACGATCGGGACCAGCGTCAAGTA
CGTGGCCACTGAGAACCACGAGCGGTAAGCCACGTAAGCCAACACGACGTTAAAAAAAGGCTGCGACGCTTTGCAAGTTTGTGTGATGGACACCGGCACG
ACGTTGTAGCTCCAGTACGTAAACATTTTAGCCAAGACCGAAAAGAGACTGAGTGGTGCGATCCACAGGATGCTGCGCATGCGAACACTCTGCATACGCC
AGACACTGGCATTGGTTGGCGAGTTTGGAAACGTCAGTACCACAACTATAACAGCACAAAGAAATAAGTCAATAATAGTCAATAAATCAATAAATATCAC
ACACACATCAAGTTAGATTCGGTAAAAAGTATGGCAACTTCATTATATTTTATTGTAAAAAAATAGAATCCCTCTTGTACGTACAGTCAAGAAGGATACT
GACAAAGAGATGGCACATCGTGAGCATCTCGGCCGACACGTGATGTTCCTTGATCAGGACTTTGTTAATAAATGTGGCACAGATCGAAAAGAGGTACCAC
ACACTCAGACAGCAGCATATCTGCAGGAAAGTACGTATAACAAAGCATCATCGGAAGCAGCATTAGAAAAGAAACAGGATAACCACGGACGAGGGTTTCG
AGATGGACACATAATATAATGACCGTAAATTCGCACCCGTAGTGCTTTATGGTCTCGTAGATGAGCAAGGGAATGGCTTGACGTGTATTTGTACCACCCT
TTCATAGGTACATTCAAGTCACCACCCTCGAGATCAGGCAAGAGGTACGGGACTTTCATGCTCGAAATCGCACTGGGACTGACTCACTGACTGATTGTTT
AAGTAGTCGCGGGTGTATTTGACAGTGGAGCTAGGCGTGAGCTGACGCTTTCTGTTCGGATGTTGTGGCTCACGTGGACTACACTAATTGGATGAGGTGC
GACCAGTTTTGTAATCGAGATTACTACGTTTTAGATGCAGGTTTACAACGGTGAAGTAGAAAAGGCGGATTGAGCAGGATTCGATAGTGTGCGTCGTCAC
GTACAGTAGCCTGGAATAATACGATGCTACATTGTATAGTTTATTTTCGTTGCAAAAGAGCAGAGTAAAATAGCCACGCAACGACAAGAGCAGGATAAGG
CGCTTAGTTATGCGAACTCACGTTTGGCTGCATCACCCGCAAACTCAAACGTCATCTTTAAAAATGCTGTTGCTATAACTCATTGTGCTGCTTTTCTGAT
CGGATCAATCTGGATTCTATGGAGAAGAGAGGCGTTAGAAGCAGCGGTAACAGGCATCCAGACGTGATAAATCGTGGCCCTCGGTTGTCGCACTTTACGC
CAAAATGTTGCTGTTAATGCTTACTCACCGAAATTCGAGCACGGACAACGTTCTCTATCAATTTTTAAATCATCATATAGTAAAGTGCAGTGTCGTCTAG
CAAGATCATTTGTCACGCTGCGCGACACCACATAGCTCGTGGACACATTTATTCATAATTCAGATACATCCAGTGAACACACATCAGAGAGGACCAAGTT
GTACTTTCGACTGCCCGCAAGTATCAACAACAGTAATGCCAATCTTCTGCATGTGTTGTCTTGAGACATAACCTACGTCTAGCCGAATATCGTTGTATAC
ACACACTGAAGCGTACTACAAATACATTGGTACTGTGCAACTGCACGTCACTTCTCCTTGCGAAGCGGTATCAACGTCATTCACGAATTCTTCATCGTAG
TAACACACTGCTTGGAAAAGTGTAAGCAGTCTAGACAACTACAAAATTACCGTCTCGTCCTCGTAAAGTCTTAAGCGCCGATCAGCAGCGTATATGTGTC
ACTTAGCTCCTTTTACTACAGCTATGGATCAGCCACGACATGCCCCACGCATTTAGTGTAGACAAATATTGTCCTTCCTAAGGACCACGCAGCACTGATT
TAGGAGCCGTCCTGGGCTTGACGTTCGGCCGACATCTAGCCTTCTTACTTGCCGTCGTTACATTCATGCTCACGACTTCGATGTTTCACGGGGATTCGAA
CAAACGTGCAATAGGTTCATTGTCGAGGTCACAAGGTCGAAGCAAAGTTTTTTTTAAAACTTTGACTGTAGCTGCTCAAAACTAAAGATCAGAAGTCTAA
AAAAGCTGTAGAAAAAGTATGCTCGGGACGCTATCAAGCGACGAGTAACAATAGTGCGAATTCCTCCTATGTGTAAAGTTATGTGTATTTTACAATATAA
GAGCCCGTACATACAAGTTAACAAGAGAGATGTTACAAGTTAAGCACAATGATCAAATATGTACATGCCCCGAATATTTGACGCTGCAGTCACTAACTGA
CCACCGTGAAAGTCATGAACCTCATTAGTTTTTTAACGCACCCGCCTAACATAATCATTCGAGCAAAACCCCTACTACAGCCAAACGCGACTTATGACCT
CGACACTTGACGTCAAGTTGAACCGCATCGATCGTATTTTCCATCCACATGTACGTTTAATATAACTAGGTCCCTGTAAATAATATTCCTTCTAAAAAAG
TAAATACTTAACAAATAAATTATTGGTATATGTACGTATGAACAGGAGACCGTGCAGGGCCAAGTCATTATCTCGTCGCCCAAGGGATTTTCTCACCAAG
GTCTGGCTATGAAGGTGCAGGGCAGTGTCCGTCTGCAGCTATCGACCACAAAACCCTCTGGATCTTCCGACTCTCTTCCCAAGAATACAGACCCTATGGA
GCTCGTGTACTTTCATCTGCCAGTAGCTCCTGCGGGTAAAATACCTGCTGGTCTTTCCACGTTCCCATTCGAGTTTGAACTGCAAGGCAACGACGGCCAA
GAGCTCCTGGAGACGTATCATGGCATTTACGTCTTTGTTAAGTACGAAATCGTGTGCGACTGCGTGCGTGGCATCATGAAGAATAAACTGCATAAAACAC
TCGAGTTTGTGGTGGAGGTACCGGTACGTCCAGGACAAGATACTTTTTGTAGGGTGCACGTGGATGTAACGTGTTATCGTGGTTGTTGTTATCTCTAGCT
GAAAGAAGCCCTGCTGGATTCACAAGAAGAGTTCTCCATCACTCCAGAGTCATTGGAAAATGCTAGACCGGTAGGTTGCTGATACAGTCGTCGAGTATAG
GTAGCTGACATCTGTGCTGTGCTTGTGTGGGGCATTTCAGCAAAGTCTGTCCGCGATGCCGCATTTCCATATTACAGGCAAACTTCACCGCACGAATTGT
CCAGTGAATCTGCCGTTCACAGGCGAGGTATGACTCGATTCCTATTGTAAACCGTTTGCCACTGAGCAAGCCGCGTTCTTGCTGACGGCAGATTATCATC
GAGGAAGCTACGAGTCCAATCAAGTCAGTCGAGATTCAGTTGATTCGAGTCGAGAGCGTCGCACATGCTGGCGGAGTTGCGAGAGATGGTACATACCGAC
ACATGCAGCAGTGCCGTTGTGCTCCTTTTTACTCGGCTAATGACGTGGTTGATCACGCTTTCCATTCTTTTGTACTGAGGACAGCAACGGAGATCCAAAA
TGTTCAGATTGGATGGGGCGACGTCTGCCGTCAAATATCGATCCCGATCTACATGATCTTCCCACGGTTGTTCACCTGTCCCACAATGCGAACCCCAGGC
AAGTGCGACTTGTACACATGCAGCAAAATGATGCAAGGCTCTGATTCTATTGCTTACGTTTATCTCTGCCAGCTTTTAAAGTTGAATTCGAGACAAACGT
CGTCGTTCTCTTTGAAAAC