Description :
From Genome Similarity Track
Location :
Scaffold_3064:734- 2890
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3064-fgenesh-gene-0.0Alpha mannosyltransferase

Sequence
2156 bases(100 bases per row)
ACTATACTGAACTAAGTGAGTCACTGAAGCCCAGGAGTCAGTAATTGGCACTGCTATTACAACAAGGCCGCCACCGAATCTGCTAAATGCGAGCTCGGAA
TATCTGGATGCCACGAGAAGAGCTCATGGAACAGCGTCACGTTCCCAATCACAGGCTCGCTCAGCATAGCCTCGTACTGCTCAACTGACTGGTGCACCTC
CATCACGCGCTCCGCACACTTTTTCAGCGTCGCAAATCTCCCACAGTCGATGAAGCTCCTGGGGTTGAACAGCTGAGATACCGAGTCCGAGTGACCCAAG
TAGATCGGAATGCTCCCCGCGAGAAACGCGTTCACGATCTTCTCCGTCACGTACCCAGGCTGTTGCTGGGAATTCTCGAACGCGATCACGAACTTGTAAT
CGGTGTAGATACTGACCGCTTTCTCGTTGTAGAGTGGGCTGAGGCGTCCCGAGAGACGGTCACGCAGCATCCCACGCGCTGAGCCCTGGCACATTCCCAG
CGCGTCGACCGACTCCATGGCGTTGAGCAAGTCAAACATGTACTCGCGCTGCGGCTGGTCACAGCGTGCGTACATGTAGGCGCAAAACTTGCGAGGGAAT
GTCGACGGCGATGGCTGATTTGGCTTTGAGAGCAGCAGCATCGGACTCTGGATCACGCGCTCGCTGAAGGACATGCTTGCCATGGACAGGTACACATGCT
TCTTCCTGGCGACATGGGCCACACTCGAGAGCAAAACCACCCGCTCGTCCAGTGCGCTGACAGCCCAGGACTCACTAGCGACCATTATCAGCGACGACTT
GTCTCCATACTGCTGGACGTACTTGGCTGCTGCTTGCTGACAGTCTGGATCCCACGCAGAGCCACAGAGTCCGCCATCCAACGCCGAGAACAAAAACACG
TCTGGGCTCAAAGCGCGTCTCTGAGCTTGTTGTTGCTCTTGGAACGTGAGCTCGTCGACCACTCGAATTGGGTTGTGCTTGTATATCGAGATGAGAAGAC
ATTCGATCATGGACTTGACCGGCTTTGCTTCGCGTGAGTACACCACTGTGATCGGTGGCACTTGTGGCTGCGCTCCGACAAACCGGAGGTTGTGAATCCA
GAGCGCGAGGTGCGCTGAGTCAATTGTTCGATCAGGGTTGCCACTGCTCACGACTTCCAGCATGTGTTGTCGCAGCCCATTGGCGAAAGCTGCACACGCA
AAGCCCGCTGGGAAAACGTGCTGCTTGATCCGTAGACAGAGGTTCGGAAGGAGATCGTCGAGCAGGTCGGTCGCTGGTAAATAGCTGAACGCCCACCAGT
CAGAGCCTGCGGAGGTCGACGTGACGTTCACAAAGACCTGCGTATGTCTGTTATCGCCACTGCGCTGGACGAAAGTTGAGAATCGCACGCCTGTCTTGAA
TGCAGAGCTGCCGTCGGACGACGCCTTGCGCCACGTATTGCGATCAAAATCGGCGCAGAACGGTCTCTTCGCCTTGAGATTCGCGTGTGCGATGCGCATC
GCACTCGGGGACAGGTCTGCATACGAGACGAGACTTTCTCGACACGAGCCCGAGTCCACGTTGCTAAACTCGACGACATTGCGCGGATGCACTTGCATCG
TGAGCAGCCAGAGCGCGATCGATGCGTCGTCTAGCCCTCCAAGTCCTTTGAGGCGGTGGCGATTCCTCCCGATGAAGCGCGCGCAGTCAGCTGAGACCAC
GAAGTTGCATCCGTGAGTGAACGGCGGCAACTCTGGCAGAGGGTACTGGTCCACTGACAGGTAGTTTTTGTGGCCTGGGTCGCGCTCTGGCGGGACCAGG
TTCCCATCTTCACCGTACATGATGTGGCCAGCATAGAGACGTTCTGGTGGCCACCTATGTGAAAGGATCAAGTCGATCAGGTCGTGTGTGCGCACGTAGG
CGTCGTCGTCGGTGATCATGATGTACGGTGCCGACGGGAACTTGGTTGTTGCGAAGTGCATAAACTCCTTGACTTTGTCCGTCAAGAGGTAGTACGAGTC
GTCGCAGTCGAGTTCGTTTGTGAGCAGATCCTGGAATATGCGCTTCTCAGTCTCAATTGCGAGCTTGAGCTCTTCGTTTGGAGGCGAGACGACACCGTAT
TTTGAGCCAAGCATGGATCGGCAGCCGAGGAAGAAGACCTGAACGGATCGGTGACG