Description :
From Genome Similarity Track
Location :
scaffold_73:73398- 75696
Sequence
2298 bases(100 bases per row)
GAGAACACGGCACTAAAGCGAAGCGCAGTCACTTAAGTAGGTCGCGCAGATTACGCAGCGCATACCTGTGCAAACTTTCATCCATTTTATATGATAGTTT
GGTGAACATCTGGGTGCCTTTGACACCGTCACGAATTGGATCCGGTCTATGCGGGGGCATCAGTCAAAAATGGCTTGCTGATATTAGCCCTGCTACACTG
CGTAACAAAATCAGTGGGTGCATTTCGATGAAATTGAGCGTCACGCGCACTTGGCGTCCGACGCTAAGACTGACGACCAATGGCTAACAAAGGAGACACG
TCGATGTGGAAGGCAGGCGGATCACACACGAATATGACTTGGGCCAAATTCTATAATCAGTATTTAGCGTCCGTGGTCTCTAGTTTGAAGTTCCAGGCAT
AGCAAAAATAGTGTATTGACTTATACTCTGTCTATCCCTGTAACGggatttcacgtgccctggaaTGAAGGATGTGGGACACACAAGATCGTGCcgtcaa
aaaaattggtgGCTTATACAATATAGtctgaccacacaatggtgtggctacacttaaataacaagtcagtacgtggctggactgccagtagttatacatt
taattaggtagatgggaaaacctatatatttagatacaggcggctttgcctaAAGCTCACATTCTAAATAGAAGATTTGAACTAGCCTTGCATtgaggtt
gtagttactcttgaagtaagtggattgccatccgctacactcgtactggttctaagtatggaatgaaggtcaccgaccctaaccaagctttctctaagcg
atagagctacggcagccctgctgcaatcCCAAAGAAATTTGAATACAGACAATGTCCACCAAACGTCGTTTTATGTGTAAGCGGGTTGTCCCTTGCTTAT
TGTGCAGTGTAACGGTTCTGCCACGGATGCTTCGGATGAGTTCACTCCTCTGTGGTGGCTTGTCAGCTCTTTCCGAGAGTCAAGGAGTGCGACCGAAGCT
GTGATGTGCCAGATCTCGAATTAGCTATCTGAACTCCTCCGTCGCACTGGCTTGAGGCACCCCACAGCAGGCCAGAACCGCGTTGCTGCTGTATAGCGGA
AGGTAGTGCAACTGCAAGAGATGGTAAAGAAGATGCTTCGATTACACGAGTTCGCTTCTTGTCAGACTGGCTCGTTAGAGCGGGATCGCGGTATGGCTTC
AGTAAGCTGGGTACATCAGGGCTGTTACCAGTACCTGGTGAAGTAGAATGCTCTCAGCCTGAAAACTCAAGGAATTTCGCAATCTAACTTTGGTAAGATT
GCTCTGGTGCTGTGGCTGCATACGACCTGGTGTATCTTTGGTCTTTATATCCTTAGGCAAAGAGACAGGGTCGTCGTCGCAGCCCGCTTCCTACAAGTTG
GAGGCGACTGACCTTGCGGTATGAAAGACTCCGAGACAGTATTTGGAACTGCTGTCTCTTGAAGATAAACGGGGACGGAAGCGGCAGGAGCTTGAGATGA
TGATTCTCACCTCGACGCCCGCGTTGTGTATTGTACGTTGCAGCGTCAAGCATGAGACGAAGATGTACGCGGTCATCAACTTTGCTAAGGACGGCTTAAT
TAGCCTTAAGACGGATGAGACGGCGTAAATTTTTCCTCACGCAGTACGCACTGAATGCGATACCCATCGGCATTTTCCAGCTTTTGGTACCTATGTAGAG
TTTGGGTTTTCCCAACCGCTACTTCTCTAAGCACCGAGCAGTAAATTTTGGTTTTGATTACTTGTGGCACTTGCAGAGCGACGTTTTGCGCTCGTTTCGC
TACGTGTGTGAGCGAAAGGTCTGCAGTATGATGGACCGGTGCGCATAGCAGTTTCGGACGGTGTGAAACGTCAGCACGGCGTGATGATTCGGTCAAGAGT
CTGCGTAACTCTTGCGCATGTTGTAGAGCAAGCTGGGCTCCTTCTATCAGGTTCCGCTTTCTGGTGACAAATTAGACATCATCGTGAGCCCCACGTCAGG
ATATACCGTCAAATTTAGCGAATGAAAAGAGCACAAAGTTTGTAAAACATGCTGAAGGTAGGTTCACCGCAAAGAACACCGTTCCCTCAGGGTATGACTA
GACCGTGTGCCGCCCGTCATAGACAAATATTACCTATGAATATGATATTCACTACGGCCGTTCTCATTGGTGAACACTTCGGCATCCTCACCCGTAATAT
CTTTAACCGCGTCGGCCTCGATGACCGCGCCTTTTATAGTGGCTCGTTGAGCAATTAGATTTGGAGCACGGGGGAGAACCGCTGGTGCATATTTGATT