Description :
From Genome Similarity Track
Location :
Scaffold_107:7338- 14684
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_107-abinit-gene-0.58Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.46Ring finger protein 32 isoform 2
Pytap_DAOMBR444maker-pag1_scaffold_107-fgenesh-gene-0.1CGMP 3',5'-cyclic phosphodiesterase subunit delta
Pytap_DAOMBR444maker-pag1_scaffold_107-fgenesh-gene-0.12Nardilysin
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.48Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_107-snap-gene-0.21Gene of unknown function

Sequence
7346 bases(100 bases per row)
TGCGGAGACGACGGATCGAAGACCCGCCGACTGAGCGAGATGGTGCGATCGAACTCGGCCAACAGAGAGTCGATCGAGTCATCCCGCGCGCGCATCGCTG
TCACGAGGCGATCTGTCGTCTTGCCCACCCGTTGGGCTAGGAAGCGTCGTCTTCGAGTGGGGTCGCCTCTGCCTCGGCGGTAGAACTACACACACTGCTT
AGtcGAGATACATCTGAATGTTCagCTCcTACGTACGTCGTGCCATAGCCCTTCCATTTGCTTTCTAGCACGGTGTCCCCGGACAACAGCCTGGCGAATT
GCCAGTCAGGACCAAAGGAGATCATCGACGCATCATTGGCTACAGTCACCTGGATGAGGCGAGCGCAACGCTCTCTGTACACACTAGCGGCCTTGGAGGT
CATTCTTTTCTGGTAGTTCTCTTTCCGACAGAGGGGACAGACACGCTGCCGCGTCCGGAGGAAGCTTGTTCTCAACACCATCAGCACTGCCTCCACCCTT
AGACCGCACAATTGACTCACCGCTCGAAGCTCTGGATGCAgAaCAAGTGGAACATGTGCGAGCAACTCAGAATGACGTGCTCATGTACGCCAAAtGGCTC
GCGGCAGATCGAGCATGGGTGGTTGGCGTCGCCGCGATCCATCGCTTGATTTTCACATCGCTCCCATTCGTCACGGGACAGCTTCGGCGGCGGCGCCTGC
ACCTGTGAACCTCAGACGTGTAaGCATCTTGTTGCGTGTAGAGCTCCAAACAGCCGCCCACCAGTCCGCGCTGCTGAGCCAAAGAGAGTCTGCGGCTcTG
CCTTTtAGGGCGGATGAGCCCACACGCTCGGCACCGCTCCTCTTGGTTTGAGCTCCCCaTCGTGTCTTCGTCGTTCTCGAACGTGCACGTTTCGCAGACC
CACACCCGGCGATAAGTGTCAAGTGctttGAAAGGCTGTGACGAAGACACTTGTTTtCcCCCcAGAGCAATCTATTCATGTGGTTCGATTCAGTCCATgc
ACTTGTCCATTGCCACACAGACACTTACTGAGGTCTTCAGCTCAGCACGAATGGCTGCCACTACGTCGCTTTTGATGGATCGTGAGGGCCGACAGGTTGA
GTTTgaGGCGCGAGGTGGCAAAGTATGAAGTGTCATTGATCGCATGATATGGTCCTGCAAAGCGGCGGCGTTGACGATAGTCGTCTGGTCCTTGAGCGCA
GCAGGAAGGCGAGCCGACGCTGAGCATAGCGATAGGTATCAGCGAAAGAGACCAAACCGTTCTCAGTGCACGCACGCTTAGTGCTGGCTCGCTTCATCTT
TCTCTTCCGGTGGCATGTGGCGCTTTCAGTTACAGCTCTTCTGTGTGTTGAGGCAGCAGTCGAGGCGTTTCAGCCCGATGTCACTGGAGCTGCCCGCCTT
CTCCTGACAGTTGCCATTGCCAACAGACGCTCGcACATCGCCCGCCATGGAGCCCAAGTTTCTCGACGATGACGACGACGTCGGGTACAAGATCAGCAAG
ATGAAGCTCGCAGACAAGCCAGGACGCGTGGAGGCCAAGAGTCTGCCTCCCAAGTGCGACGAGTCACGCGTGGCGGAGGCCAAGCTGGATCTGGAGGTGG
AGAGAGAGTGGAAAGAGCTGCAGAACGACACGGGCGGAGGGCGCATCGAAGTCTCCACCAACCCTCGGTCGAGGAAGATCTGCAAGGGACTGACCATGTG
AGTCAATGTTCAGACGAGACCTCTGGTGTCAGGACCTGGCTCATTCTCGTGTATGTCGTAGCAATCACATGAATATGAGGTgCGCCGACAGTGGGAAgTT
GATGTGGCAGTCAGATGAGTGGTACGTCTGGTGATTCACGTGGACAACCAGCGCAAGACaTTAAACTTCATTGGATGCATTGCTGAAGGCGTGACGACGT
CTTTTCGGTTGAACAAGAAGGTGAGGAaACCTAGTGGAGTATGCTATGACACACCAATTCATTGTGCTgagAGCAGCGCGCATACCTcGCGCCATCCTCA
AGTGCTCGGCCGTCTCGCGGGAGATCAACTTCAGCTCCGTTGAGGAGATCACGCAGTTTCGCCTCGAGCAGCGTGTGTTCCTCGACGGATGTTGCATCGA
AGGTGCGGCCACCTGACGCGACATGTCCATGCTGTGGTTTTGAAATTGTGATCTGTGTAGAGTGGCTCTTCACATTCGGTTTCGTGATTCCTGGGTCTAC
CAACACATGGCAGCAGACCATTGAAGCAGCAGGACCAGAGAACATGCTCGATCCGGAACAGATGAGGTGGGTGCAAGCGATTGAAACGAGGGTTTTGCGT
tCCTCTCACACGGTGACGTTCTAGCGGGAAGCTCACGATCGAAACAGGCTTCTACGACGGCCAGCAGCCTATCGCCAAAACCGTCTACAGAATATATTAC
GTCTAGATCATCGCGAGTGACCAGTTACGTGATGGAGATCGCACGTTCACAAGCTGGTGAGCgCCGATGCTATTTCTCGGCTAAGTTtGAAGCGGTCAGG
GTAGTAGGGCAGCTCCGTTTTCAATGCGTAAAGATCAGTCACCACTGTCGGTTCCGCAGCAGTCTCCTTTACCTTGCGTCCGCTTTTTCGGCGTGGCTGC
GCTGCCTTGTGCTTGGCTTCCCCAGTCACGTCCACACTTGCTTGTCCAATCACTTGAACAACAAGTTTCTTTGGAGCCTTGATGATCCACTCGCGGTAGT
AACTCAGGAGCTCTGCCTTGGTGCAATGCTCAAGCTCACTTGCGAGCTGCTCGTTGATGTCGAACATCAATCGCCCAGACGTCACCTCGTACCAGTAACG
CTGCGTCATTTCAGTGAGGTTGTGATCGGGCTCCAGCTTCTTGAGGATCTGAGCCTTgATGTGATCCTGGAAGTGCTCCTGAGGCATCGACTTGATAGCG
TGCTCGAACTCAACCAAGAATCGATCGATGCAAGAGCGAaTGTACGCAGAAGTGAACAGGGATGACTGTACCATCACTCCAAAGCCGATGACTCCATGAG
TCAGACGCACAGTACACGAGACGTcGTACCCAAGCTCTTGCTTCGTGCGGAGAGTATCGAACAGAGGCTCTTCCATGAGCTGATGAAGCAGGTCtGCGTA
CGCGAGCAGTCGCACATCGTGCTCGCCGAACTGGAAGTAGTACTCGACATGAGTGTTCTTGTCATCAGCGTGGTCACTGTTAGCTTGAAGCAGCAATCCA
GACTCCACcACTGGCAGCTGGTGGATGTGGCGCTCAGGCCATTGATCGTCGCTGTTCATAGCAGTCGAGGAAAGAGCCGAAATTCCGTCCTCAAGCACCT
TCTGGAGCTCAACAGCAGTAGAGCGAGACACGTTGCCATGCACAAACGTCGCCAAATATACGCTGGTTTGCCACAGCTCCCTGGCCACGAAGCTGGCAAG
GCGTTCCAGAGTCGCACCCTCAGCGGCGGCCAAAGATTCTTCAATACGGAAGCTTTGTCGTTCGAGAAGCTGAAGTCGCAAATACTTGGCTTTGTGCGAG
GTTTTGATTAGCGCGTTtTTGTAATCCCGCACCATGTCTTGTTTAATGAGCTCAAATCGCTGCGGATCAAAGTGTGGCTGGAACAGCTTTTCCGTCACAA
TTTGGACAAGCAGACCTAGCTTGTCATTGAAACCACCGAAGAGTAGCTCCAACCCACTCTCCTTTACTCGTAGCGAGTACATGAGCTCAGCAACGCTGGC
ATGATATGCGTACTCGTTGAGAGCATCGCGTACGAGTTTGACGTACAGTTCCGTGAgCACAATCGTCTCAGCACTCTTCGTGACAGATGGAAGCTGGATC
AAGAAGGCGAGAGTCGCACGAGGCGTCTGAAaCACGCGATCAGGCTTGAACCACATCTTGCCGAACGCATGCGGATGGTCAGCtACATCTCCGACAAAGT
CTGATTCATCAACAAGGGAGAAGTCGCGGGGAATGAAGGGGTTCTGGCGAGGAAGCTTAATATCTTGATGGACGTGGGAGACATTGGTCCACCGCATgAT
GGTCTCAGCAGGAATCACTTCTTTCGAGTACTTGACTCCAAACCATTTCTCTTCTAGCACATCCTTGTGgAAAGACTCAATCTTCTCACCATGCGTCTGG
GACACAAGGCACACACGCACAGTTGAGGGAACCAAGTACTTCAGCAAAGCGAGGACATGGTCTTGCTGAAAGTCGCCGATGAACAAGTCGTACTTGAGCA
GATCCTCAGGTGGCACCTGGAACATGTCTTGCATGAACTGGGCGAGTTGCTCGCACAGCTCAACGGCGCTGTTGTCTTCCTGGAAGCGGAAGGAAATGTC
CGCCAATGCTTGGAGCTCATCATACACCCATTGTGGGCATCCAGACGCGCGGAGCATGACCAGGTACTCAAACACCGACTCAACAATCTTATCCCATTGA
TCGATTCCCTCGAGGGTGAGCTTCATCGTGACGTCGAATCGAGCGCCAAAGGTGCCAGCATCGAAGCCGTCAGTGTCAGTCACTCCAGCTGTCACCGACG
AAATCCATCCTTGGCGCTTGAGCTGCaCATGCAAACAAGTTAGTTTTGTTATACAGGAGTAGATGCCAGTGAaCACTCACGTGAGGAAGCAGTGATCCCT
CgCTCTCGTCGCCGATGAGACTGGCGATGTATTCTGCGGGCTTTTGTCGGTGGTTCCCGAAGATGGGAGGAATCATCCAGCTCAGGTGGAGAATGTGGAT
gTCTCGCACTGGTACAACACGACACAGCAGCGGCGACTCGTCGACACCCTGGCCAAATGGGAAACCAGATGCAGCGAATTCAGGACGCGCCACATTTTTG
TTGGCGATTGGGCTGAAGGAGGCTCGGACCCACTTCTCCAGGTCGTCGAGCGAGTCTTCTCCGCACACCACTAGCTTCATGAGGTTGGCAGAGTAAAAGT
GCTCGTAGAACTTGAGGATTTCACCACGCACATCGACTCCTTCACGCTCAGGGTCCTCCTTCAGACTTAGTCTGTTACCCCAGCCAAAGCGGTGGTACGG
GTGTGTGGGCGGCGAGGTGTCACAGAGAACCTGCTGCAGTCTCACGAGATCGTtCTGCGTAGCTTGGCTGAACTCTGAATCAATGGCCGACAGCTCTCGG
TCGAGTGCGTCTGCCTTCATGAGCGGCGAGATGAAGAACTGGGCGAACATGTCCAGTGCCTTCTCCAGATGCGCAGGGCCCACCTCGAAGGTGTAGCTCG
TGATCTCATTGTCTGTTTGACCGTTGCTGAAGCCGCCATGCGCGCTCAAGAATGACTCGAACTCGTTCTCGTCTGGGTACTTTTCGCTCCCCATGAACAA
CATGTGCTCGAGATAATGGGCGAGACCGGgAAGGTTCTCCGGCTCGGCGAAGCTTCCAACACCGACCGTAAGACATGCGCCAGCACGACGTCGTGCTGGT
CCGTGCTCGTCGTCGTCACCATCAAAGGCGTTCTGCTCGctGCCATCGTCGCTGCTCATGTCGTCGTCATCATCCTCGACGTCGCTCTCCTCGTCGTCCA
TTTCCATGCGCGCgTCCTCGTCGTCTGcACCCGCGCCAGTCACATCAACAGTGGAGATGAGCAgCGCCTGCAATGCGTTGGGCAGCGTGAGCAGGCGATA
CTGCTTCTTGTCGCTGGGGGACTTGGAGCTCTCCACCACGTCCATGGTAGCCGTCATGATGGAGGGTGTGTACatggTATGGGAGCTCTCCCTTAGTAGA
TAGTTAAATGAGGGACATGCTCCTAAAACAGGGGACACGCACGGTTGCTGTCGCCATCCACACACCAGACAACAGGTCGTCGAGTGCCAGGAATCGCGCG
ACCATGAAGCTCGGCAAGGCGTtGTCCGTGGAACACATCAAGCGCATGACGCTGCGCACCGTGCGCGAGAACAGCGAGGGACAGACCGAGTTCCTCGCCT
TCATGAACGCGCTTGAGCGCAACGACTTCGACGAGAACCTGTGCAAGCGCGAGTCGAAGCAGCTTGAGAAGATCATGACCGCCAAGGTGCGTATACTGCG
TCCATGAGGATGGAAAGAGAGGGATGGGTGGTTGcGCCATCCATTCAACATTTCTCGTGCGCTTGTGTACGTGTAGCACGTAGTTCTCGAGAACTGACTC
AGATGGTATTtCTGCTTATGATGAATAGGCCCAGCGCCGTGCCGCCGAGCACCGCTCAACCCTGAACTTCCACGTCATCCGCATGTTGAAGGGTATGCAC
CGCAGATAAGCAGACCGAtGCATGCAGCAGCTGGTCTGGATCAATATAGGACTCGTGTCCCAGCCATCgaCTTCCGTAatCGTGTTCTATAGGAGTGCAT
GACCTCACAACAAACACGCCTCATGGACCATCATATTGCAGCACGTTATGGGCTTTGTGCAAAGACATtcGATGATCTACACAGCAAGTAAACGAACTCA
CCCGATGCGCCATCTTCATTGGAGCTCTCATGGATGCTTGTCGTGTACTAGTAATTAGCTTGGCTTCGGCCGGGGATTcGCGTCCTACTTTGAcTTTCGT
TATATCAATACGTTtGCTGTGATTGGGTGTCTGCGGTGCATTTGCATTCGGAAGTTTGAATCTGACTGACAgcACGGAGCCATGGAGGCGCTGCGTAGTG
GCCTGCACGAGCAGAAGGAGAACGTGGAGGCGAGCATCACGCGCGGCAAACTGACGTACAATGGTACGGAaTGCATGAGGGGCGGAAAGAAGAGCGGCGC
CTGACGATGTGGATGATCAGCAGAGCTGCCAGGCAAGTCGCAAGCAGCCAGCACCAGGTTCCATCCATACTcAACCCCCAAGTCGTCGAAGGTGAAAGAT
AAGCAGAGCAGCAGCACAACCAAGAAGCctAGGTGCATATGTGTTGTATCTGCGTTAGCTGAGTGATGCTCACAGACGAGATATGCTCTGTAGACGTGCG
CTAGGGGATATTTCAAACCAGCACTGCACACCAACGGACAACAACAAGACAGGAGGTAGCATCTCGAAGCGATCAAGTGAAAGTAAGCTCAAGTCCAGTC
TCAAGtCAAGTcAAACGGCGTCAGCGAAGAAGCTGAGAAAGGCATCGGTGCTCACGACCACACCAAAGCGCGTGAGTGCAGCCCGCGATGATTCAGACGT
AAGTTCATATTGTTCATGGTCATGAAAGATCCTGAGTAACGAATGAGGAcATCTAGGACATTGAATtAGCGTATGGAGGACTCCCGACTCTCGGGCCAGA
CCCGGACTATCTCGAACGGATCCGCCAAGAAATCGTGAAGGAGATCTACGACGACAAGACGCCGAGCGTGCTGGACGACTATGAACGCTCGGAACAGACA
gTTAGCTCCAATGCTCCGTGGTGGTCAATCGAGCCTGCTATCGtCA