Description :
From Genome Similarity Track
Location :
Scaffold_13:733733- 736948
Transcript NameFunction/comments
Sapdi_VS20SDRG_05227hypothetical protein

Sequence
3215 bases(100 bases per row)
CATGTGATATTACGGTATTTTGCTCACTTTACTGGTATTTGTACGGTGTTATTCCGGCCGGTCGATATAACACTATTTAACGTCAAATGCACCCACCTCG
CTGGGACTGCAGTCGTAAAGCAGCGTGCCATTATTGTGGGCCGCTTGCTGCACCTTATTCTTGTGGCACCTTTTGTAGTACTGTACGTGGCCACGACTCG
ACGTCGTAGGGTTGTTGCCATGACGTCTCGTTCGTCTCGATACCAACGCGATGAGAAAATGCACACTATACAATGACAAATATACGCAAATAGTATGCTC
GCAAAACGACAAGGGAGCGTGGGTTTAGTCGAGGAATTCCTGTGGGCTCCATCCGACCTGGCCGACCATGATGATGGACTACGACTACCTCCAGCAGCGG
CTGCAGCTGCGCGTGGACCTCCTCGAGAAGCGGCTCGTCGGCGTCTCGGAGCTCATCCTCGCGCCCAAGGCAAGCGACCTCAGCCGCGTCCGCGTGCACT
GCCGGCAGATGAAGGTGGCCCGGGTGACCGTGAACGGCCTCGACGCGCGCTTTGAGCAGCTCGACTTTCTCTCCGAGGTCGTGCACGAGAGCTACCGCGA
CTGGGCCTCGTACGACCTCTTCTACCGCGGTGCGATCGTGGCGTCCAAGGAAGGAACGCTGGTGATCGAGCTCCCGGCGCCCATCGAGCGCACGAACGGC
CAAGCGCCGAGCGCGTCGCAGGCGTCGTCGGCCGACGACAATGACAATAGCAACGTGACCGACGACGACAGCAAGCACGCCAAGGACAATGCGTTCTGGG
ACTTGGACACGATTCCATCGAGCCAGACCGGGTACGAGCCGCTGCGTATCCGCGTCGAGTACGTCCTCGAGGACCCGCGCGGTGGCGTCCGCTTCCTCCT
TCCGGACGCCGACCACCCGAACCGATCGCCACACATGTACACGTACTGCGGTCCATTTGGCGGCCTCTGCGACGGCGCGCGCATGTGGATGCCCTGCCGC
GACTCGCTCAAGGACACGTGCACCTTCCGCATCGAGCTTCTCGTGCCCGCCTACTGCGTTGCGATCTGCAGCGGGCGGCTCGTGGACCAGTCGCTCGACG
AGTCGTACCGGTCGTTCCGGTACGTTGTCAACACCAAGACCAACTGCTCGATGCTTGGCTTTGCGGTCGGGCCGTTCCGCATGTACATCCCCGAGGCGAT
GCCCCGCATGACGTACTTTTGTCTCCCAGAAGTCTACGAGGACCTCGTGCACACAACGTCGAGCGTCCATCTCTCCAAGTCGAACAAGGAGTCGACGGCC
CACCAGCCGTACCCAACGACGTCGATTCTCGCGTTTTACGAAGGCTACCTCAACGCACGGTACCCGTTCGAGACGTACCAGCAAGTGTACGTCGAGGACC
CGCCGGACGAGGTGCAGTACTACGCCGGCGCGTCGGTCCTCGACCAGCGCTCGCTCTACGGGCCGACCATCATTGACCGCAAGCTGCCGTCGCACCTGCT
TCAAGTCAAGGCGTTTGTCGGCAGCTGGATCGCCGGTGCGATTGGCATCCAGACCACCAAGGACGCCTGGGTGCTCATTGGCGTCGTCGGGCACCTTGTC
AACGCGTACGTCAAGGTCGTCTTTGGTGAGGAAGAGTACGGGTATCGCATCCAGCTGGCGATGGACGCGCTCACGACGATCGAGCTCACATCCGATGACG
CGCCGACGCTCATCTACCCGGACGTTGACGTCTACGGCGAGTACGACCCGTCGTACGTACCGTTCCTGGAAGCCAAGGGACCGTTGATTTTGCACATGAT
TGAGCAGCGCGTGGGCCAGAAGCACTTGCAAATCTCGCTCCAGCGCATCGTCGCGGGCTCGGTGCCGACCGAGAGCTACGGCAAGCAGCCGTCGAATGGC
AACAGCGGCAAAACCAAGCACGACGACGACGAGAAGGACAAGGAGAACGACGACGACGGCGATGACGGGGACGACGGCAACACGTCCGTCATCAACAGCA
ACCTCGACGAGACAGCAACCAAGACCGGGCAGCCCCAAGCGCTCTCGACGTGGTCGCTGCTCAGCATCGTCAAGAGCATTGCGGGCGCATCAGGTCAAGA
TTTGTGCCGGCTCTTTCTCCAGACGTGGATCGTGCACGGCGGCCTGCCCTTCTTTAGCGTCGGTTTTTGGTACAACCGCAAGCAGACGCAAGCCGAGGTC
GTCTTGGAGCAGACGCTCTTGCCCGGCTGTGAAAAGTACACGGGCAACATCAAGATTACGATCGTGGAAGAGCAGAGCGAGTACGTCCACCACAAGCGCA
TCGAGTCGCTCCGGCACAAGTGGGAGTTTCCGTGTCATTCGAAGGTCCGCAAGAAGCGCCGCACGCGCCAGAAGCTCGACCAGAGCGACGACGACTACTC
GTCGCAAATCTCGGGCGCGGGCATGGGGCTCAACGACACGCCGGTGTACTGGGTCAAGATTGACCCCGAGTGCGGCTGGCTCCGGCACATTGTCATGTAC
CAACCCGACTTTAACTGGATGGAGCAGCTGCTCAGTGACTCGAAATGCGTCCGGTCGCGCGTCCACGCCGCCCGCGCCCTTGCGCTCTACCCGCTCGCGC
ACGAAAAGTCGCATGTCATGGCGTGCCGCGTGCTCACCGAATGCATGCACGGCCTCACGACCCACTCGCGCCGGCTCCGCGCCGAGGCCGCGATCGCGCT
CGGGCTCTGGCAGTCGCTGCATGCGCCCATGACCAACGCGCGCACGGACCTCCCGGACTGGAAGGGCATGCACAACCTCGTGCGCATCTTCAAGGAACAC
TTCTTTGACCGGACCGCCGACATGCCGCTGCCCAACTACTTTTTGCCGTCGGGCGGCAAGGTCATCTTGGAGGTATCGTTTTCTCTTTGTTTTCATGGGC
GGCGTGGGTTGATACAATATTGATATTTTTGTCGCTAGTCGGTGGGCGAGGAGCAGTCGACGACGAGCCGTGACATTCAGATCCAAGACTACGCCGAGGG
CGAGTACGAGATCAAAAAGGCAATCCCGAAAGCGCTCGCGGTCGTCCGGTCGCGCACGGGCTTTTCACCGCCCGAGATTGAAACATTTCTGCTGCAGCTG
CTCATGCAAAACGACAACTCGAAGAACTATGTCGAAATGGCCGACGAAAGCTCGGTCGCGGACGACTGCTTTTACGTCGGCAGTCTCATCCTCGCGTTGT
CCGTGCTCGTCCTTG