Description :
From Genome Similarity Track
Location :
Scaffold_146:7337- 15736
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_146-abinit-gene-0.71Nuclear inhibitor of protein phosphatase-1
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.12Callose synthase

Sequence
8399 bases(100 bases per row)
GCTAGTTCCTCAAGTGCGTCGTtCGGTCGACCCACGCCAGGAAGCGGCGACGCGACGGCAGCGCGGCGCGGCGCGGCGACGAGCCTTCCGCCCAAGTACG
ACGACGTGACGTACGTAGCCGACGCCAACGCCAACGCCGACACGACGCCCCCGCAGTGCACAACCCACGATGGAGCACGCGCTGCGCCTGCCCAAACTCA
ACCTCGGCGGCGCCTTCGCGTCCGGCGCCTCGGCGGCCACCCCCAAGTTCCTCGACCCCATTGAGCCGCCGACGTTCCCCTTCACGTCGCCCGGATGGAG
CCTGCCGCAGAAGCCGCGCTCCATTGCGCTGCTTGACGTGTTTAAGAACCATGAGCTGCTCACCACGGTGGGTGATGGAGGACGAAGAGGACGAGGAGAA
CCACAGACGCAACTGACATTGATGTATCGCTCGTAGTACACAGTTGACCAGAAGGCTGTCTACTTAATAGGCCGCAACGCCGTCGTGTGCGATATCGTGC
TGAACCACTGCTCCATCTCGCGCCTGCATGCAGCAGTGATCCACCATAAGGATGGCGCCGCGTACCTCGTGGACCTCGGCTCGTGCCATGGCACCTTCGT
GGACGACGTGCGCTTGAAGCCACTGCAGCCGACGCTCATTGTGCACGGTTCGACGCTCAAGTTCGGCGCATCTTCCCGCTCGTATTCGTTCAAGGTGCGT
TGTCCCCcTTcACGAGTCGTTCCCATGGGATCTGGTGGCTCACCTTCATGCGCTTGCCACACAGTCCTTCGAATCGCATGACGAGATCATCGAGCGTGTG
CAGTCgCGGATAGAACTGGATCCAGACGAGATGGAGGTtGAACAGAACACGCTGCTCAACCGCGCGCTGTCCTACCGCCTCGGGTTCTCGATTCCGCACT
CACaCAAAGCGGACGCCGAGGGCGAcGACCCCATGgCGCTCTTCCCCAcGCGGCAGATGGAAGCGTCGACATCGGCaTCGTCCATGATCCGCCGcACGCA
ATCAGAAGaCAACACGATCGCCaGCACGTTCCCGCTGTGCCCACAGTCCACCACCACCACGCAGAGCAGCGCACTGGTCGCCGCACGTCAGGCCGAGCCC
GGCCGCAAGCGGTCACGCACACAGTCGGCGGGCGTGCCCATcTCAACCACCAGCCCTCCACACGCCACCGCAGAAGATCCGGCCTACGACCAGGACGCGG
ACGTCGTCTGCAAGCGCGTGCACTTTTCGGAGCAGCCGGCCGAGACCATTCCCGAGCGCGTCGTATTTTACAGCCCCGAGCAGACGCCAGCGTCGTCCCC
TcTGCTCCTCGGCGTGGCCACGCCGTCGGCCTCCACGTCTCCTCCTCACCCACCGGTGCAGCCTCTCCGACTAGACGTGCCCCcgCcAcTGGATATCAGC
ATCATCGATAAGCCAGAGAACGATGCGCGACGGCCATCGTCCTCAACAGTGCCGTCTGTCGCGTGCAATAGCGAGGCGGCGCTGCAtCTCCGCCAGGAGC
AAGCGAGCCATGAGGCAGCGAGCTGAGCTCCCgCCCGAGGAGCTATCTCTATGTAAGCACGAGTGTGAGAGTATGGAAAGCGATGAAAGATGACtAGGGC
GAGATGCGCCGTAACATAATTTAAAGTGGCCATGATCAAGTCAAGAGTCAATGAATGTCTTACGAATAGTATGAAGAGAGCGACTGAAGTGCATGGGCGG
CGCGGGCTCTAAGGAGCGCCGCCGGCAGGAGACTCGAACATCTGGTAGTTCGAGTGGGAGCGGCCACGAGTGCGGCTGAGGTTGCGGCTTCGACCAGGCG
TGCGAGCGCTACGACGCGACTGGCGATCAtGACGGACACGCAGACGCTCTTCTTCGGCCTCTTTCTGGGTGCagACCATaCCGTTGCGACGTGCTCCCGT
GGCGATGAGTAGCAGAGCCAACACGATCGCACAGGCGGCGAGAGCGTAGAGGTAGATGTACTCGTTGTTCTTGTACTcGTCCAAGTGGgAGCGGATGTAG
AGCGAGATGAGAGGGATGAGGAAGAACAGCATGAAGTAGAACGTCGAGTACACGACGCGCTTCTTGGTCGTGAAGAGACCCACACACGTGAGCCAAAGCA
CGGACGAGAGGCCGAGACCGGAGAAGAAGTAGCACATGAGACCGACGATCTGGAGCATCAGGTACTCGTTGTCATCGACCCACGTGCGGGACTGGACATT
GAAGCCCATGATGATCACGAGCACGATGATCGGAAGCAACGTCACCATCATGATCTTGCGGTGATCcACCTTGTCGATGAAGAAGAACGAGAAGAACGCG
CCCAGCAACTGGAGTGACACACAGTTGATGAACATGTACTGGCCATCCGTGAAGTTGCTGTACGCCATCGACAGGTACATCGCGAGTGGTCCGTTGACAA
ACGCCGATACCAACATGCTGAAGAGGCCTACAATGAACTTGAGAGCAGTCGCTCCGCCGTCCTCTTCGACTGACTCCTCGGCACGAATCGAGTCAACTTC
TTCCTTCACGCCCTCCTTGCGACGGAGAACTGCCAGGCATCGCTCCAACGCCTCgaGTCCTTCGCGGGAGTACACCCAGTATGGACTCTCGGGGAAGATG
TACACAGCCGGTGTCACCAAAGAGAGCACGATGGTAGCCACGAAGACCTGCCAGATCCAGCCGATCGAGTTGTTGGACGAGGTGAACCACGCACCCGCCA
GAGTACCGATAATGAAGCCAAAGCCAAGCAGCAGCAGAGCCTTACCACGGAGATCACGCGTCGACACCTCGTAGATGTACATCGCGATCGTCGGAAGCAA
AATGCCAACTGCACAACCGAGAAGACCGATGCCTGGGTACAGGAATCCCTCGCCAGAGCTCTGCACAGCGCTGAGACTGATCATACCAAGAATGGCCAAC
AGACCACCGCCGACGATGGACAGACGACGCCCGATGAAGAAGTTCATGAGGCCGGCCACCAACACACCAGCAGCATTCGTGAAGTAGAAGACGTAtGTGA
CTGAGCCGTTGCCGGCCTTGCCGTCGAGTAGATCGTAGGTTGTGACGTACCCGACAAAGTCAGGCGACGTCTCAAGAATCGTGAAGAGATAGAACAGCCA
ACCACAGCCGACACCGCCAAGAACACCCATGAAcGCTGCCAGCGAGAAAGCGTACTGAGATGACGCGGAGACGACCTCGGAAAAGCCCTTGTTGTACATC
ATACGCGTCTGGATCACATTGAGGAACGGAATGCCGGACATGATGAACAGAGGAATGATCATCGCGATACAAAAGATGAAGTCGAAGAAGAAGGCCAGCT
GCTGGAACATACCGATTGAAGAGATGGACGAGTTGTGGAAGCTCCACATACGCGCCATCTCGTTGATTCCGTACAGCGAAGCCAaGTAACCGAAGAAGAT
CGACATCGCCGATCGCGTGTCAGCATCAAGCGCATACGACGCGAACAAGAAGTACGCAACGAGTGCAACAGCGAGGACCACAGTGTAAATGCTGGCTCGA
GTCACAGGACGCATtGAACTGGTCAAATTCATCGCACCAAGGATGCCCAGGAGCACCACGGTCGCAACACTGGCACCGAACACGAGCGCGACAACCACCA
TATCCCATCGTAGCGTGATCACATACCACAACAGGAAAAAGTGACGACTCTCACGCAACAATACTGTGAGACGCGCGATTGGCTTCGTGTTGTGGAAGAG
CTTGAGCTCACCCTTCCACCAACCAATCCAACCCTCACACATCGTCTTGTCTTCATCTTTGTAGTCTTCAGTAGCGTACATCCACTTGGCCCAGGCACCG
ATGTCCGCCTTTGTcTTTTCCCAGTCAAGACCATCAGTGTTGAAGATGAATGGAGAGAGAATCCAAAGCACCGAAATAAACCAAATCGCAAAAGTCTGGA
CGCCGAAACCCTGTGATGTCTGGCAGAAGAGGAAATAGGTCGACTTGTTGTCCGTTGGGTTTTCATCACAGATCTTGAATTCACCAAACGTCAGGTACAC
CAGACACAAACCCACGAGCTCGAAGGCTTTGCGGTAGTGACTGCTCGCGTACGCTTTGTACAACAGCACGAAGgTTTCACGAGTAATCTTGAAACCACGA
CCAGTAGCCTTGTACTGGGCTTCACCGTGGAGCAAGTTGTTGTCGAAGTAGTGCATGGTAGTACCAACTTGGAAAATAAAGAAGGCGGGACCAGCAGTGA
TGATCATTTCTACGAGGCGAACGAAGCCACGACGAAGACCCATTTCACCGAAGTAGACGGCGATGAGAGGCAACGACAGGAAGAGACCAGCTTGGATGTA
GAACTGCGTGTTGATGACAGCGTCAGAGTCATTGAACACGCGCTTGTCGAACTTCAGCAGCGTGTTTGCACTtATGATGTCGACCTTGTCCATGTTGATG
ATCATATCACGTTGCACTCCTGACAGCGCAATGTACACTTTGCAGTACATGTAGACAAAAGTAGTCACAATCGTCATCCAGGTAGCGAAGTAGAAACCGG
TGTGGGAGTAATACATCGAGTTGAGCCGGAAGAAGtCCAGGAACTGACCCATACGGTGAGCTTCACGAGCCAACGAGGTCTCACCAGCACCGTTGGCTAG
CTTGCCTTCGAACATCGAGATCTGAGAGAGAGCGACATCACGACCCTTACCACACTGCATGAACTCCACGTGAGTCACAACACCACCGCGAAGAGTACAG
TTGAAACCAGCGAAAACATCTTCAGAAAGGTTGATGCCTTTGCTTGCCTTCGAAAGACCGCCACGAGTGATCGAAAGAACTTTATCAAACACATCGGGGT
GGCCGTAGTGCATGCGGACATACAGGGGACTTGCGAGGACACGCTGGGAGAGCGTCACAAAGACCAACTCCTGCCATGTCTTAAACTTGGCGAGGGACGA
AGCGTTACCTGTGAAAATGTGCTCACGCATACCAATAATCTGGACTGGCTTGCGTGAAGGATGCAAATCAGCAGTCAGAAGGAGCTGTGGCATCTTCAGA
CATTCCTCGAAGtAGTGTTCCTGGTTCATATCGATCGTCTGGACGAACTCGCCAcGAGTGAACTGCAAaGCGTTGTTCTGGTTCTCTGGCTTACCTTCAC
CCAGAATCGGATCGCCAGGCAGCTGGTAGCGGTAGACTTCCATGATATCACCATTTTCGCTCTTGATCAGCACTGTATCGTAGATGTTCGTGCCATCCGC
CGTCGGAATGGTGTCAACGTAGGCGACACGCAGGTTCGGGTATTCACGCAGAAGGTAGTCGATATCATCGGCCTGCTGCTTCTTCTCACTACGGTGCTTT
CCGTACACTTGACACGCACAAATGTATGAGAACTTGAGTCGGACCATATCCTGGAGTTGCGACTGCTTCTGCTCTGCACTCTTGTTCGGGTTAGATCcGA
TCTCGAGCCAGTGAAGAATCTTGATAGCGTCTTCGTACATCATCATACCCTGTACGGTTCGCGCAAGAGTCTGACCACGGTAAGAAGCCCACAGACGAAT
CTCTTGCGGGTGCTTTGCCTGGGCCTCTTCAGCGCTGCTGACATCGATTCGCTCCAGGAAATTCTCCCACTCCTCTGGGTGAATCTTGCTGAGGTACTTG
AGAATCGTAAGGTTCTTACCGTCTTCCTCGACCTTCTGGAAGATGGGATGGTTCACCAATGGGTTGTTCAGCTCTTCCAGTGAGAACAGAACTGTCTCAG
AGTAGAATGGTGTGACCACGGAGAACGAACGCATCtCCTTCAGAGCACGGAGCTGAGGAATGTCCATCACGAGCGACTTCATGAAGAAACCAAGTCGACG
TTCCGCTTCACCGCAACGTGGCATGGCTTCTGATCGTTCCAAAGAGAGCAGCAGGCACGCACGAGTCGCTGCGCCCATCGCAGTATCACTGTAGAACAGG
TTGACTAAGCCACGAGCTGCGTACAAGTAACCGTTCGCGCTGGAGCAGAACTTGGCATTGGAAAACTTTCGCTGAAGGGCTGGGTCCGTACAAAACGTCT
GAAGAGCGTTgAGGAAACCCTCCATCTTCGTCACAAAGTTACGAATGACTCCGAGGTTGTGCACCTTTACAGATGGCATATGCTGTGATGGCACTTCTGG
GTCCTCGAGGTCAAGAACAGCTTctAGAAGTTCCAAcGCAGCCAAACGAAGACGCGGCAACTCGTGAACGTTGAACGACTTCATGAATCCACCCGAGCTC
GCGATATCTTCGATCACTCGGAATCCGTCGAGAACATCGGCATCGTCATTGCCAAAGAGAGCACTGAGAACAAACGAGCCAGCCGTGTAGAAACTGCGGA
TAGCTGAAAGGCAGTCACTTTCAACCAGGCTGACGCGAAGCTGAGACTCTCCTTTGCCTTCCTTTGCAGTGCGAATGGCCAACTCCAGGGCCTCACCCAG
CTTGCCTGCCGAcAGGAACACCGGTTCAAACACCTCACCATTGCTTCGGATATCGTACTGCAAAATAGCGGCTTCCTTGTCATCCAAGAGATCAGTTTCA
CGGAACGAGTTCACGATTTCATTCCACACAACCACGAATCGAAGCATCATTTGGGACTCGTAGGCAGCAGCCATCGCACTAGCACGAGACGTCTCGGACT
GGTAGGACGCATCAGCTGACCGGGCAAGGCTTGTGACAATCTTCTGGTCGAAGAGTTGAGGAGCAACACGGAATGCCTTCGTCATTTCCTTGACGCCTCG
AATCTCACCAGTCTTCATAAGGACACCCATGAAAGCACCAGTCAACGCCTGGAAGATAGTGAAGTAGATTTGGGTGTCGTAGTTGAAGATGAAAACAACG
GGGAGCCACAAAGACACGATAAGACCAATGTtGTGGAACGAGACAAGAGCGCCACCCTGGTAGCTTCCGCTCAAGTCCATCTCGTAGATGGCAATCGACG
GCAACATAAGTGGACGGACCAGGATGAAATAGGAGACCAGAGCttttAGCGCCCAAAGGATGATCCAGAAAATGATGTAGCGAATCTGGTACGAGAATGG
TGGCGCGAGGTTGCGACCGACGTAGCAGCTAGCACCTTCACGGACAAACTTGGCGGCGAAAGTGCCAGCGATCAACTGAGGGGAGAACGCTTGAATCAGC
AGAACCACCACgCCGGGAAGAGCAAAGCCGCCGGCAATCGGAACAAACTGTCCCAGCAGCTCAGTGTCCCGCTTCTCGTTGAAaGGCACGTAGATCATGA
TCCAAAAGAGCGCCGCGAAACCACCATTCCACAGCAGGCGCACAACAAGAGCGGATCCGTACGTGAAGGAGCGAGACGACGAGGCCTTGGCTTCGTTGGC
GGTGAGAAGGTGCCAGCCGTGAGCCACTTCAAGCACACACTTGCAAAAGCCTAGAGCAGCGTGGGAGAAGAAGATCGCGACAATCGACAGcTtGAGATCC
CGATCGGTGAATGGGAAGACAGTGTTGCCGAGCTGACCAAACTGACTGAAGCCAGTCTTGCCTCCGTCTGGAGAGACCGTCACACAGAACGCGAGCACGA
TCAACAAGATGAGGAACATCATGTTGAACTGGAAGATACGGTAGTAGTTGAGGACGAGCGTGAAGATACTGCGATGCTCGTAAAAGGTCTTGCCATGCGT
GTTGGTGAGGACTTCACCCACGCGGTCCACGTCCACAGTGAGACAAAAGGGCTTCCAGAAGTACTCATTAATATCGTCATAGTTGCGGATCTTGACATGC
TCCAATGGCTTGCCCAGGTTGTTACGACGCTTCATATTGGAGCACTCGGTCCAGATCGGTCGAATCACGTTGGCGAGGAACCATCCCTCAACCCGTCCGT
CCTGGCAATCGGGATCCTGGTTCACCATTGTCATCATCTGATGGAAGAGGTAGCAAATGCACTCGGGCATGTGACGCACGTTGGCCGACTCACCCcAAAT
CaGAAAGTAGAGCATGATGTCCATGTGCAGTTGGTGCTTCAGTTCGCCGGTGGGCGGTCCGTTGAAAAAcATGGGCGAAGTACCAAGgAACTTGGCCCAG
tCGCGGTAGTTGGACATGAGCTTCTTGTGGAGTTCGACCACATGTTGATCAGGCGCGTCCGTGGTTTtCAAGCGCGCCTTTCcgTtGGCCAGTaGCAGCA
CGACATGCTCTCGCTGGTTCGACACGGATCCTTCCTGGAAgccgaacttggccttgagcttcNNNNNNNNNNNNNNNNNNNNCGTCGATGCTGAaCgccc
cACCTGTGgTCGGTGCGTTGCTGCCCGTGCTCATAATGGGGATACCGCCCTTGCTACTGAACTTGCcGCCCGAGAGAATCGTCGGGTTACTGCCCACATC
GAGCTCCAGCAGACGCGAGCTGAAgCGGTCGCTCCGCTCCGACTTGGTGCGTCGCCTGTCGGCTTCCAGCTCGAAGTAGTTGGAGCTGGCGCGACGCCG