Description :
From Genome Similarity Track
Location :
Scaffold_802:7330- 9208
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_802-snap-gene-0.4Conserved gene of unknown function
Pytap_DAOMBR444snap-pag1_scaffold_802-abinit-gene-0.17Secreted protein

Sequence
1878 bases(100 bases per row)
GAAGAAAGAAGAAGCCCATGACCGCAGCCCCCAAAGAACGCGGTCATGGGCGCGCGAGAAGTTGCACGCGGAGCGGAGAGCGCGGAGGAGGGGCTTGGTG
GCCGGACGCTTGCTTCGTGGTGGTGGCGACAGCCGCTGCATCCCCTGCATGGCCAATTTGTGGCCTGGGTGGAGGCCGACCCGGTAGCCGACCAGTCGCT
GATGATGCCACGAAAACGTGGCTAATCTTGGACAGCACGGTCGAGGCGCAGTTGCCGCTgCGCCAACAGTGGATGCCAAATAGTGCCAGCGGGAGAGAAT
GGAGTTGCGGGTCGATGGGTAGGATGGTTTCGAACCCGAGCTTGACGGTCCAGTTGCTCCACTGTGTCCAGGTGGCCAGGTACTTGCGGTTGGACGACTG
GGCCAGAGCTGCTGGCGGAGAACGTGGCGTAGATCTTGTGCACGGTCGAGGGTACCGGTGTTTCCTGCCAATCACGAGAGAGGTTAGTCCAAAGATCAGT
GTGAGGCTGGGTCCACGCCCGGGAGCCGGCGTCGGCCATGGTGTTGAGCGCGCCCGGGAGGTGTTGAGCGTGTAGGCGGAAGCCGAACACGGCCTCCTGG
AGTCCGATGGCGCGGTTGATCTCGCGACTGTACGGGTTGCGTGATGAGCGTGCGTTCGCCCACGCCACGGTACTGGTATTGTCACTCCAGCAGTGCACGT
GGGTGATGCTTGCGCTTCCCGTGTCACACCAGGTGTGGCCCCACAGGGTGGCCGCGAGCGCCATGCACAGGTGCTCGCGGACGTTGATGTTGAAGTTGTG
ctGGATCTGATCGCTTTCTTGGCTCGTGATCCAGTGTCGCTCTTCTGCGTCGTACTGCACTTGAATGTACTGTTGACGGGCAGGATCAAGTACTACGAGC
CCTTCGTTACTGGCGTCCATATACAGATGCACATCCGGACTAGCCACCTTGGCAAACATGCTGGTTGGTAGCCCTTTGAGTTGACCGTGCGCGAGAATCC
ATGCGAACCACTGGAGATCCAATCGGGCTGCCTCGGAGAGCCGCACGCGTCCGACATGAGGTGCGCCGTTGGCTACAAATTGAAGTGCCTGGTGGAAGGA
TCGCGCCGCTGGTACGCACGTGCAGACGTGTCTCAAGCTGCCCAGTAGTTTTAGCAACTTGCTCTTGGTTGTGTAGCTTCCGGTTTGCATGTTTTGCACT
CGGCTCAGAGCCTTCTGGATTTTGTCCTCGGGCATGGACACGGTGCGCGCCACAGTGTCGAACTCGAGTCCAAGGACACGGAGCTTGGTGGTCCATTGAG
TAAACTTCTTCTCATTCACTGCGCGTGATCAGAGGACTGCGAGCATGGCCAGTCGGAGTGCTTGATTCCCCCAGTGAAGTCTCTGTCCAATGTCTGGCTC
GACCATCACGTGGTCATCTACCCATTCATATCCAAAGAATGGAACGTCATCGAGTTCTTGGCTGCACATCGACGTCGGCGACTCGCGTGTGACTAGCCAC
GTGATGGCACCGCCGAATACACCGTAGTAGGCCGGTGAGGCTGTCCATCCAAATGGTGCTGATACGTCGATGATCAAGGCGTTGTCGGTTGGCAGCTGGC
CACCCTTTCGGTGCACTTGAGTCGCTCGATTCATCAAGTGGCGGTAGGCCCCcTTCACATCTCCGCTCATCATCATGATGCGCACCCCGGGATACTGGTT
GGCTAAAGCCTCGATACGCAGTGCAATTTCCAATGCTGGACGGTAGCACATTCTTGGCAGACCTTCAGTGATCGTATCGCTGTTTGTGGAGTCGTCCTTT
GGGCACGACAGGTCATGCATCAGTCTGCATACGTCCTTGGGGTTTTCGTCTTTCTTCTCTACTGCGCTGAAAGGGCTG