Description :
From Genome Similarity Track
Location :
Scaffold_334:733- 2179
Sequence
1446 bases(100 bases per row)
CGACTTGTGGACCCAGTCGAGCGTCGAAAACCGCGTGTAGACATGTATGGTCCGACCGGCCAGCTGGGTGTAACACACCTTCAACAGCTGCAGCAAAGCC
AGTACTTCCTTTTCCGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGCACTCGGCCGCAGAAACGCACCGGGTGCATCAGGCCATCGTGCTCCTGCATGA
GCGTGGTGCTCACGGCCCATTCATTTGGAAACAGCATCACATGGACCTCTCGGTCACGGTCGAAGTGTCGGAGGACAGGTGCCTCACCGACCTTTCGTTG
CAATGCCGCGAAGCTTCGCTTGGCTGCAGAGAGGTCACCCCCTGGTGCGAAGTCTTCGTCTCGCAGCTGGTAGAGCGCGGCACCGTAGACAGCAAAGTCC
TGTATGAAGCGGCTGTAGTAGTTCAGAGCGCCAAGTAAAGCTTGCACTCCCCTCTTGGACCTTGGGAAGGACAGCTCGGTGATAGCCTTCAACTTCTTAG
GGTCCGCTCTAATACCACTCCGGGACACTTCGTGAGACAGGAAGTCCACCTTGGGCTGCACAAAAATGCTCTTGGTGAAGCTCACGCTGATCCGACATTC
CTCGATCCGGGCGAGGAGTCGATCGGGCGTCGCTAGACATGCATCGAAAGACTCGCCACCAAAGCAAATATCGTCAACGAACGAACGCCGTTCGAAACCC
GGCACCAACGAAGACTCGTCGGGCTCTCCATTCGCAAACATGTCCGCAATAGGACTGTTGACTAATTCCGAGACCGAGCTTTCGCTCGATCCGAGTCCAA
GTCCCGCTTCAAACTTCGTAGGCGACTGGTCCGGGTCGGACGACTCTTCATGTGACTGTTCAGTCGAGGCGTTGGCGAGTTCACGGTCGCGTGCTTCAGC
TTCTGCCATCAGACGCGCGTAATGCTTCCATCCACCCTTTAGTTGAACAAAGCCCCACAGAGCATTGTCGAGCATTCGTTGATAGATCATAGGTGCATTT
TTAAGCCCAAAGGGCATTCTGAGCCACTCGAAAGGACCTAGTGCACACACAAACGCAGAGATCTGACGAGCCCTCTGTGTCATCATGATCGCCCAGAATC
CACTCGCCGCATCAAGCGAGCAGTACCACAGATACTTCTCCAGGTCTGTGAGCAGATCATCCACAAGGGGCATTGCATACTCCATGATAGCGGTGACTGT
GTTCGCCATCTTGTAATCAATGCACAGTCTGATATCTACGCCATTCTTCTTCAGCACAATCACGATCGGTGACGACCATGGGCTGTTGGAGAACGCGATC
AGACCTGCCTTGAGCAAACCTCGCAAGAGCTCGTAAAGGTTCTTGAGGTGTCGGAGGGGAATTCTCCGGGCTCGTTGCTTGATAGGCGCATGGCCCTGCA
CATCGATGTCGCACACTACACCGTACGCAGGCGGTGGTAGAGCATT