Description :
From Genome Similarity Track
Location :
Scaffold_44:733- 1893
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14964hypothetical protein
Phypa_INRA-310PPTG_14965hypothetical protein

Sequence
1160 bases(100 bases per row)
GTGGTTGAAGCTTCGACTAACGTTGCAGCACAGTCTGCTGCTGTAGACGCGGACGTCGCAGAGCCATTAGAATGTGCTACTTTAGCTGATCCGGCAGATC
TTGTAGTAGAGCGTGGGGAGAATGCCAGTAAGAAGAGAAGCTGAGCACGACCAGACGTCCCCTAAGCGATGAAAGAAAGAACTATTTTACAAAAATCAAG
TGTATTTAGTTCTGGTACAAATTTCAAGTATGAAATGGCACGAACCAGAACCTGTGCTAAAGAGTAAACATATTCCAAATGGCAGTTTGTTTTATTTCTA
CAAAGAGGAATGCGAAGATGTCAACAAGTGCAGGGTCGGTCGCTCGAGAGCGAGCTGCTTAGCGCGCCAGGTACGAGATCTCCAAACTACCCATGCGTGC
TCACCTTGTACTAAGCTTCATGTTTACCTATAGCGCACTGGATGCAACGTAGTATTGGGCGATCCCTACGTGCTTCTTCCCACGCTAGTGCATCTCAGAG
TATGTTACTGCTACAAAAGCTGCCTCGACCGCTGCAGCGCCACCGAGATGGAGCTTTTAGAGAGGACCTTTACGCTGGTGCACGCTACAAGCTGTCGCTA
CAGGAGCAACATCAACAGGAACAGAGACGACAACAGGCCCAGAGACGACAGAAACTGCAGCCAGCATCGAAGATGCAGGACAGCTTCATGGCTGCTGAGA
GGTACTTCGAGGCTCATGTGGGTCACGCCAGTCACGAGGAGAACCCAGATATGGAGGACAGTATGGTGGCCGTACCGACCTACGCGGATGTAAGTCACCA
TGTCAAACTGCTTACGACGCAGCAGGCTCACTGTAAGAGACCATGAAAGGTAATTAACTGGAGACGGATGTACTGCTGCTGTGTCTAGTGCTGGGATGCC
TGTGACGACGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN