Description :
From Genome Similarity Track
Location :
Scaffold_11:732709- 737886
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004915Similar to ABCA1: ATP-binding cassette sub-family A member 1 (Homo sapiens)

Sequence
5177 bases(100 bases per row)
TCTTCGACACTCTCCAGCGCGAGCAATGCGGGAACGTGCCGTCTCATGTGCACGGCGCCGACGATGACCGCGACGCATTCGTGCTGTAGTGCCGCTTCCG
AGGTGCTCAAGTGCGAGACGACGTCGGGTTCGCTCAAGTACTGCAAGAGCGTGATTGACAACAGTTTTGCGTTGAAAAAGCAATGTGGGTTGTCGCCAGA
AAACACCGGGCTCATCGTGGCGTGTGCGATCATCGTATTTGGCTTCGCTGTGCTCATGGTGCTCTCTCGCGTGTACGCGAAGAAGCAGCTCATGGCGTCC
AATGCGCTCGAGTCGCGCTTTGCCATTGCGGCGATGTCGAAATGGAAAGCGATACTAGCCACATGGCACCAAATCACGAACCTGGTGTGGAAGAATCTGA
TTATTCGACGACGGCGCCCCATTTCATTCGTCATTGAGCAATTCCTGCCTGTGGTGCTCGTGACTGGCTTGGTGTTCATCGCGAACCTAGACACGCTCTT
TGGGGACGACAGCAGCTCCAACAGCGGATACGACGACACCGAAGCGTCAAATACCACGACAACTATTCTGTGTACCGATTTGGACGAGCTTGACGAAGAA
GCGATCGGAGCCCCAAGCGAGAACATGTCGACCTTTTTCTCCACTGGACAGACAGTGATTGGTTTGTTCTTGTTGATCAGCTACATCAAATTCGTGTCAA
CAACAACGACAACGATGGTTATTGAAAAGGAGACGCGGGTTCGAGAAGTGATGAAGATCATGGGGCTCTCCGACTTGTCACTCTTGTTTTCGTGGTTTGT
GACAAACGCGGTGCTGGCGACTCCGCTCGCCTTTGTCATTGCTGCGGAGTTGAAGTACGGGAAAGTCTTTCCAGGCGCGGAATATGCGACACTAGTGTTC
CTGTTTTGGGCACTGAGTCTGGCGATCGTGAGTTTCAGCTACTTCATCACACCGTTTTTTAACAAGTCTCGAACGGCATCGATTGCGTCAGTGTTGCTGT
GGCTGATCCTTTTCTTCCCGTTCTACTTTGTTCAACCGAAATCCAACGCACGGAAGTACGCGGCTGCATTGTCCCCACCTGCTGCTTTTGCGCTAGGCAT
CGACGACCTGCTACGCCGTGCCCAGCTTGGCACAGGGCTTGCTTATTCCATCGCGGTTGTCGAGTCTCCGATTACTGTACCCACGGCCTTCAAGATGAGC
TGGTTTTTGATGCTGGACTCCTTTCTGCTATTTGCTTTGGGTTGGTACTTAGAGCAAGTGCTGCCGCAACAATATGGTGTTCCAAGGCCGTGGAACTTTA
TGTTCAAGCGCGAGTTTTGGATGAGAGTTGAGCCTGAAGAGGAAGATGCTCCAGTCATGCTCTCGTCCCCTCGTGACGATTTATCATCGCCTCAGACGAC
AAACCCTTACTCGTCTGGATCAAGTACAATGCTCCAGCATCAAGCCTCGAGCGATGGATCTGTCATATTTATGAAAGAGCAGTCGTCGCTCGAGAAGAGT
GTTGAACCTGTCAATACGACATTAGCAATTCAAGAAGAAAAAGGAACATGCCTACAGATTCAGGGTCTTCGCAAAGTGTTCGCGGGTGACGATGGAGACG
AAAAAGTTGCAGTGAACCAGCTGAACCTGACAATGTACTCGGGTCATATCACTGCTCTTCTTGGCCACAACGGCGCTGGTAAGACAACAACCATTTCGAT
GCTCACTGGTCTCATTACACCAACTTCCGGAGACGCGAAGCTTTATGGACGTTCGCTGAAGCGCAACTTTAACGAACTTCGTCAGATCATGGGTATCTGC
CCCCAGCACGATGTACTGCTGAACGAACTGACAGTGGTAGAACACTTGCAGTTGTTCGGCACTATGAAGCACATTTCTCCCAACAAACTTGACGAAGAAG
TGGAACGAATGATCAAAGAAGTGGGACTGACTGAGAAGAGAAAGACTCGGTCGAAGGATCTCTCCGGGGGCCAGAAGCGGAAACTTAGTGTCGCTATCGC
TTTCATCGGTGACAGCAAACTTGTGTTTTTGGATGAGCCAACTTCCGGCATGGACCCTTACTCCCGCCGTTTCACGTGGAACCTGCTGCAACGCAACCGC
GAAGATAGAGTCATCGTGTTGACGACTCACTTTATGGACGAAGCTGATATCCTTGGAGATCGCATTGCGATTATGGCAGATGGCGATTTGTGCTGCGCTG
GTAGCTCTCTGTTCTTGAAGAATCGGTATGGTGCGGGGTACAACCTGACACTGATCAAAGGATCTCATTGTGATGTTGAGGCAGTGGGCCATTTCTTGCG
TCAATTTGTCCCAGATGCGAAATGTCTGAGCAACTTCGGCTCTGAAGTCGTGTTCCAGCTCCCATCTGCTTCGTCCAGTATGTTTTCGAGTATGTTGCAA
GCATTGGACCAGCACATGCATCAAATTGGTGTTGTCCAGTATGGCATCTCTGTTACAACTCTCGAAGAAGTTTTCTTGAGAATTGCGCAAGATCGCGAGG
AAGGAGCTATTGACAGTCTGAACGACGTTGACTGTGTTGGCCAAAGGAGAAAGACGTCAGCAACTTCGATGAACTCAAGGCCAACTCGAGGCCGTATTTC
GTCGACTGCGACATATGAACCAAGCTTCTGGACCCAGTATTCTGCGCTCGTGACAAAGCGTTTTCGAATCACGAAGCGAGATCGAAAGAGTTTGATGAAT
GCTATTATCGTTCCGCTCATCTTCTTGATCATCCTCGTCCTGCTTCCGGACATTGACGTGGCAAATTTTCTGCCTGATGATTATGCTTCTGGGATTGCGT
CTCAAGTTCGCCAGAGCAACTGTACTGTTGCGAACTTCACGATGGTGTCGTATAGTACCTCGGACCAGACATATTGCCTATCGAACAGATTCGACTACTG
CGACATGGGAATCATTGACTGCGATGTCACTGCTTGCTGCAACAAGTACAACGCTATCTCTCCGTACTATGCCTGCAACTTATGTGACCGTAGCGCTTCC
CAGCCCAACCAACCGAAGACACCATGCTACAACAGCCAATGCTTGGACCGCGATGGGGCTAAACTGCAAGTTACTTTGAACGGTTTCCTGGTGTCGGTCA
TCGTTATGTTGGCGTTCGCGTTTATTCCAGCAGCCGTGGTCGCGTTCATCGTCCGAGAGAAAAATCCTATCCAAAACGCGAAAAGTTTGCAGCTCATATG
TGGTGCAAACATATCAGCCTATTGGTTTTCAAGTTGGACCCACGACATTTTTCTTATCCTGATCTCCGTCGTGGCTGCAGTAATCATTGTGCCCTTCTCA
AACCGCACATTGTCGAGCTCCACCGAGGTTATGGGAGTTGCAGCTCTGGTAGGCTCGCACGCGATCACTGTGATCCCGTTGGCGTACCTATTTTCGTTCC
GCTTTGAGAAACATGCTGTAGCTCAGACGTCGCTGCTCGTCTTCGCCCTGAGTACCGGTGGTTTGTTGAGCATCTTCTCCTTCCTGTGCCGAATCATCAA
TTTCGAGTTGGCACCGAGCAACCCAGACAGTATCACGCTTTCAGAGCTGGACCGAAACTACTTGCGATGGATATTCATGCTCTTTCCGGGATACAGTCTG
AACAATGGAATCTATGAAATTGCCTCGCGGAAGCTCAGCAGAAGCGCGCTTTTCGGAACAAGTAGTTCGGGAAAACCTTCTTCATTCTTCGGTTTGTGGG
AAGGTCTCGGCAGAGACCCAAATTGTGTATCTTGCTGGACGAAAAATGTCAGTGGTTGCTGTGATCGCGACGTATTCGATGTCGACGTGGCCGGAGCTCC
GTTCGTGTACATGCTCATCGAGACAGTGCTTTTCACGATCCTCGTTTTTGCGATTGAGAACCGACGCGTGGTCTGGAACCCTGAACAAAGACGCGCACAA
CAATTGAAACCGGAAGATGATGACGTGGCAAGAGAGCGTCGCAAAATCGAGAGCTCCCGACCAAGCTCCAACGACAGCATCTTCATTCGAAATTTGTGCC
AGCAGTATGGGAAGGGAGGCAAAGTAGCACTCAACGATTTGTGTCTCTCGATTCCGAAAGGAGAGTGCTTTGGTTACCTGGGCATCAACGGCGCAGGCAA
GTCGACCACCATGAAGGTCTTGACCGGACAGATTGCACCAACGAACGGCTTCGTTTCACTTGGCGGATACGATCTTTCTCAAAGTCGCGGCAAGGCCAGA
ACCGTGATTGGGTACTGCCCTCAGTTCGACTCTCTCCATGATTTGCTCACCGTGAAGGAGCAGCTGGAGTTGTATGCGCGTCTAAAGGGAATCCCAGACG
CTCTTGTGCCTCTCGCTGTCGACGAGAAGATCAAAGAAGTTGGTCTCACTGAGTATCAAGATAAACTCACGCGTGGATTGAGTGGGGGCAACAAACGAAA
AGTATCCACTGCAATTGCGTTGATCGGCGCGCCAAAGATTATCTTCCTGGACGAACCTTCAACTGGTGTTGACCCAAGTTCGCGGCGCAAAATGTGGGAC
GTGATTGCTGCTGTGTGCGCTGAAAAGGAATCCTGTGTCGTGCTGACAACACATAGTATGGAAGAGTGCGAAGCGTTGTGTACCCGCGTTGGCATTCTCG
TGAGCGGAAAGTTGAAGTGCCTTGGAAGCGTCGAGCACTTGAAGCAAAAGTTTGGTCGCGGGTACACTGTGGAAGTAACACTGCGAGAACCAGACACCGT
CGCAATCGGGAAGTTGTGTGATGAAGTAGAGCGAATCCTCGGGAACACCACCTCCAGCATTTCTCGCGACAATGTGATGAATGTTTGTTCGACTTTGGGT
ATCGCAAAGCGAGGGCAAACGATCTTGACAGGAGAAGGAAACGGTTGGGTTCTTGGAAGCTACTTGGACTCAGTGGGCTCCATTCCGGTCGATATCTTTG
CCTCGTGGTGGTTATCGGAAACCTTGAGCGAGACACTACAAGCATTTTTCAGTGCTAGGTTCAGCGGAAGCGAGCTTGTGGAGCACCAGGGTGATCACTT
TCGGTTCCAGGTGCCCAAGCACGCCTTGCGGCCACACGTGATCTTTCGGTTGCTCGAGGAGAACAAACGCCAGCTTCACATTAATGAGTACGGCGTCAGT
GACACCTCTCTGGAGCACATCTTCAACAACATGGCTGCACAGCAAGACGAAGAGCGCTTGGTCGCAAATGGGATGTA