Description :
From Genome Similarity Track
Location :
scaffold_680:7327- 10298
Transcript NameFunction/comments
g9834.t1 DEAD/DEAH box RNA helicase, putative
g9835.t1 hypothetical protein PHYSODRAFT_284180
g9836.t1hypothetical protein

Sequence
2971 bases(100 bases per row)
TCTTTGCGTTTCCGCATGGCACGTTTAACGATTCCAAACAGAATGTCTGTCTGCAATGTACGTTCGTGAGCTTCGTCCAGAACCACCACCGAGTATCTGT
CGAGAGTGGGGGACAGCAGCGCCTCTCGAACGAGCATACCGTCCGTCATGAACTTGAGTCTCGTGTTCTTGGACGTCGTATCATCGAAACGGACGCAGTA
GCCGACGGAATCTCCCAACGGGCCACGGTTGGCCTCTTCGCACACACGCTGTGCCACAGTGATGGCAGCAACACGACGCGGCTGCGTGATGGCTACACGC
GCATGGGCACGGTCACTTTCCCAAATGTATTGAGGGATCTGCGTCGTCTTGCCACTGCCTGTTTCGCCTACGAGGATCACTACTTGATTGCCATTGACCG
CTTCGATGATTTTGCTGCGGTGCGCGTAGATGGGGAGGCGTTGGCGAGTGCGCTGCAGTTCCGAGACAGCTGGGTTGCTGTTGTTGTGGCGGCGCTTCTT
GTGGTGCTTGAAGCCTTGGCTAGAGGACGGAATCGGACGCTTATGCTGCGCATTATGCTGCCCGTGGCTGGGAATCGTCATGGTCAATTGACTGGAGGTT
AGTGGCGATACTGAGGCCAAGTGTCTTGGAGTTTTTGAAATGAAGACAAATGATTGGATGAAATTGTGCCGGGTGCACTTCAACGTCAAGGCTGACGAAC
TGTCAAAAAAGGTTACGGTCTCATTTGACTCGAGCTTTGCTCTCATAAAGCGTGCGTTAATTTTCAGCTACCGCCTCTCACATCCGGCCTTTGCGGCCCA
TGGCATGCATGCGCTGCTTGGACGGAGCTCTGATTGCACAACAGCATGTACAGTGCCGTGTTAGCAACTTTCCGAGTTATTATTCGCAACAAAATGTACA
AATTAGCGCTATGCTCACCCTCGTCGTGGACCACTTTCCGCATACAGAGCGAAGTCTTCGCCCGAGCGCAAGTTTCCACTTCCAGACCCGAAGCCTTTGC
TACGCTCATTGGCGCGAGCAGCCATCTTGGTGCGAATCGCTTCCTCCCTCGAACGCTCCTCCTCCTCCTGCTTTTCCGCCAATCTGGCAGCAATGAACAT
CATATAAGCATTAGAATGACACCAAACAACACAACAGTGCAGCGCGTTTCGTACGCGAGAATAGTGTCGATCTTCGCGCATATATCGGCAGACTGCCCTT
TCCAGTTGGTGAGCTTCTGGATCATGTCGTCGATGTCTTCATGGTGCGTGTCACGCCCGACAGCATACTTGACGACGAAGCTACGTGATTTCTGGTCTAG
CTTGCCTTGAATCAATCCCTGCAAGGCACCCGGCGATAAAACAACCGCAGAAGTAAATATGCAGTTCATCTCTTCTCATCACCGCCCGCTGTACTTACCG
AGTAGATAGTGTCAATGAGGATATCTTCCACATCGCGCACCGTTGACACTCCCAGATCCTGCATCAGCGTGTCGTATGGGATGTTCTAACCAAAGGCATC
CCGTTAGCTCTATTTCACCCACTTGTCGTCCAATTCCACCCACCTTGAATCTGTGTGCGAGAGACACCGTCGTTAGCTTCCGGAGCTTGGTCACCTGCTG
CGGAGTGAGTTCCGGCAGTTCGTCCTTTCGAGCTGCAAACATAAAAGCACCAAGTCAACCCACCAGTCCCACAAAATTACTATACCGAGATACCCAAGTA
AACCCACCGATGTAATCGTTGTACACGCCGAAGCAGAAGATGCGCAGCAGCTTGTAGTGCTCCTTGTGCTCCGAGTCTTTCAGCGCCTCCACGTTGGGCA
TGTCCAGCAGCTCGCGGAACACGAACAGCTTCTTGTTGCTCAGCACCTGCTGGATGAGCGCCACACACGCCCTTCCACGCGCGTTCTTGGCCAGCAGCGT
GAACTGCTCCAGACTCGCCGCCCCCGCTGCGTCAAAGGCCATCGTCAGCTAAAAAGCTTTTTTTCTCGAAGTAAAAATGGGCGAATCTGTCAACACCTTT
GTGTTTGTGTTTAAAACACAATATTGAATCAATCATTTCACTACACGTTTCTAATTGTTTGGCGCGCTTTTTTAGAAACGAATTTTGATCATGGATGCGG
AGCTGGAGGCCACGATCCAGGCGGCGCTGCCGAGCGCTCTCAAGATGGCGCTGTACGCGGCTAAGAAGCAGCAGCAGGAGCTGTTCAAGTTCGCGGTCGA
GGGCGCGGAGTCGCTGTACAACAACGCGGCGTTTCTGAAGGACCTGGAGGACCAGCAGCACATGCAGCAACTGGGCGACACCGCCAAGGAGTACGCCGTG
CACCAGACGCAGCTCGAGCGCTACAAGACGCAGCTAGAGAAGCTCGAGCCGTTCGTGGAGAGTGGTAAATTGGACCAAAAGAAGATCGATAAGGTGTTTA
AGGACGCGATGGTCACGCCGCGCATCAACGCCACCAAACACTCCATCTACAAGAAGTTCTGCGATAATGCGGGGGTATGGGATGGTTGTCTGGCAGTTTT
TACAGGTTGTTTTCTTACACTACGTGCTGTTTTGTTTTTACAGATTGAGATGGAGGTGGACGGAGACGACGACGTGTTTATCCAGGAGAGCGAGAGCGTC
AGGAGCACAATCTGTCCCGTCACGCAGATGGAGATGGAGGACCCCATGCGGAAGTACGTAGTGTGAAATGGTTGAGTGTTTGTTGGTCATAGTACTGATG
TTGCTCTTGTGTAGTCCGCGGTGTGGGCACACGTACTCGAAGAAGGGCATTCAGGCTCACTTGCAGCGCAGCAGGAAGTGTCCTGTAGCAGGTACGATGA
GGCGGATAGGCTTTGTTGCTGTTTGAAGTGCTAACGATGAAGTACAGGTTGTCCGCAGCAGCTATCGTTCAACGGTTTAGAGCGCGACATCGAGATGGAA
GTTGTGATTGAACGCCGGTACGATTGCTTGTTGCTGAACAAAATGTCTTCTTTGGGTCTGACGCACGTGGT