Description :
From Genome Similarity Track
Location :
scaffold_6:73268- 74601
Transcript NameFunction/comments
Pl_112769myosin-like protein

Sequence
1333 bases(100 bases per row)
TACCGCGGCCTGTGGAGCGCTCAATCATGTGTCGCGGCTTGAACGACGTTGGTGTGGTTGCATGACTCGGTGCATTGAACGCAGGCTTCGGGGCTGATCG
ACCGCCAGCAGGGGAGTTCTTCATCGGGTTAAACGAAGCAAACGTCGGTTTCGGCGGAGCAGCCGACGGTGTTGCTGCAATCGATGGAATCGAGTTTGTC
GTAGCTAGGAATGCTGCCAGCTTGCTCTGGGAGCGAGGCTTCGTCGAGGAAGCGGGCGACGCTGATGGTTGTTGCTGCATAAAGCTGTTGAGTTTATTGG
CGCCTCCCGTATTAACGGATGGCTTCGATGGAGCGGGGGCTGGCATATCCGGCTTCGGGCTGCTGTTACCTTGAGCGAAGACAGCCTTGCGCTGCGCAAA
CTGCTCGCTTGAGGTGCCGCGACCTCGGACAGGAGCAGACTTCGGAGGAGAAGGAGGTTTATTGCCCGCAGTGGGAGAGGCCGATGACTTGCCACCTGGG
GCGGAATCATGTGTTGACTCTACAGCAGGCGGGTTGGATTTCATGAAGGCCGCGAATTTGTTCCGGGCATCCCCACCTGTCGGCTGAGACTTTGGGGGTT
GTTTGGGCGACGGTGGTCTCCTTACCGTCGGTTGTGGCTTGGGTGCCGGCTTGGGTGCCGGTGGCTTCCTCACTGAGTTGGTCTTCTTTGGTGGACCTGA
CGGGCGTTCAATATGCGTCAACGGAGATCCATGCGCCGCTGGTACTTGGCTTAAGAAGGCGTTCAACCTGTTCGAGTTTGCACCTCCACTGTTGCTCCTC
ACATCCTTTTGAGGTGGTGGTGCCAACGGCGTCGTAGGGGGTGAACCGGATGGCGACATCACTCCCCCTCCGACCTGAGGTGACACTGGCGGAGGCGTCG
ACGGTGGTGTACCGTCTGGCGATTTGTCCACGACCTTCTTACTCGATTTCTTCTTCCTCGATAGGAATCCGCCCTTCATGAAGCTCGTGAGTTTATTATT
GCTGTTGGTCTTCTTGACTGGCGATGTGCCTTGTGAGCTTCCAGTAGACGCCATCGACTCTGCATCTGAAACAGGGTCCTCCTCATACTCGCCCGTGTAC
CCAATGGTGCCGAACCTGTCAAAGAGGATAGAGAGTGTCTCGAGGACTGTCGTAAAGTCTGCACCGGCATCTAACAAGTCGTCAGGCTGGAAGATTTCTC
CCTCATTCAGTCCCTGCTTCTTGCACCACTCTAAGAAGAGACGGATGTTGGCCTTCGAGTGGAAGACTGTGTTGAGCTTGTTCACCTTGAGATTGGCCTT
GGGGTCCACGCCATTCGCCAGTAGACACAGCAA