Description :
From Genome Similarity Track
Location :
Scaffold_10:73211- 75593
Sequence
2382 bases(100 bases per row)
GCTCGATTTAAGCTTCATTGTCTAGCTAATGCTTTTCTGTCCGTGGCTTGCTGTTCTCGACATGTGCGTGTAAATTATAGGCTTGATAGACCGTGTGCGC
TCAAAAACAAGTCTAGGCCTGCGAAAAACGATGTCGTAGATGAATTGTTAGCCACGAGAATGACAAATGAAGGAAAGAGACACACTATGCAAATTGTACA
GCTAGCATGGTGGTGGCAAAACGCAAGGAGCTGTAACATGTGATATTTTGTGATAAATAACAGTGGCTGACCATTGGATCATCGAACCCAGCGTCAGCAT
GTTGACTCGTCAAGTGACGTCGTATAGATTTCTTGGTGCTGTCAATACTTCCATCACCGCACAGCCGGATTCCAGATTCTATAGTCTTACATGGCTAAAA
TTTCAAGTTCTTTATTGGAAACTATCCACTGCTGCTTGACAGGATCTTCTCGTCAGAGCTCATGTGGGCATATTATTTCGGCTACTACATCCATCCATTT
AATTACCCGGAGGCGTATTTGATCAGCAGCTCACAAGGTAGCTGTATGAAGACATCTTACTGCATTTAGCCCCTTTCACACTCCATAGAAGATGGTAAAA
AAATTGGGTGGTGGAACTGGTGTTGCTAAAGGCGTGTGTGAACATCAGCCTAGATTCATGGGTGATACGATGTAGAGTATTCGATTGGTACAGCTTCAAG
TCATCAACCTTAGGTCTGTCGTATGCGCCGTGAATACAACACAGAAATTCTTATATCTGGAATGCCGGCTCCAGCGCCTCTCCGGTGCCGCAACCCTTTG
CCACTATAGGTGTGGTATATTGGAGACGGCGATTGATATATCTTTCGACTATGATTTTGCCGCTCAAAGTCTTCATACTTAACTCGTCCGTGTTACACAC
TATTTAAATCGTGTCTTAAAAGGAGACCAGTGCTTATAATTGAAGTGGAGCCTACACTGGATGAGAAACAGGCTGACGGGTACAGAATCTTCATGATTTT
CAATATCGTTTAGGCGGTTAACCTCCGCTTTCTTTAGATGAATTGTAACGATCTTCGATTTAGTGATGCTGCATTAACCCTTTAAGGGATTTAAAACCCA
CTGTTGTTGATCTCTATGCTGAAAAATTTATAAGACTAAGTCAATTGTATTTCAGCCAGTATAATTTTGTACTCAGTCAAATTCACACTTTATTACCGGC
TCTCTAACATTCAACAGATTCGGACTTCGGTGGATTCGGCCTTACTATTCCCAAACGAAATATGTTACCCCTCATAGACTTGAGCGTCACTCTTCCGTTT
ATAATAATTTTACCAATTTTTCCATTGACTTCGCGTACTTTATTTTCTAGGTCCCATTAAAGTTACAGAGTCTTTTTACCGTACCATTAGCATATGGTAA
TCTGTATAGCACTATATATGGAAAAGGATGCTACGAAGTCGCGATATCCCTACTCTTGAGAGATTTTTGGGTTTCCCTTTATGCTTTGCTATTAAATATT
CGCATTTAGACTTTTTACTTGGACTTCACCTTTGGCATTTGCCTTTAACCTTTCGCCGTATAATTATTTGGTCGTTAGGGTCTTCTCTTTCGAAAGTACA
GCTTTGTTATAGGTCTCCTTGTGGTCAAGGCTTACGCTGATTTGATTTCCTTATAGCATAGTCAATTTGCGTATTTTTGCCGCAAATTGACTATGCTTAA
ATTATTACAGACCCTTAGCGCATCCGACTACTAGAGTTATAGTTATATAACTGGCTACTATTCTAGGACGGCTTTCAGTTCAAGATCCAAGCTAGCTTAA
AGTACGAATTATCGTTTTTTTACCAGGTTCTGGTGGCTACTCCAACACTACAGTAACCAAGGTATTTACCACAGACCATTTAACTATGATCTACCCAAGA
GTTATAAAATTTCCAATTTTGCCGCCCACGGGGATCTAAACGCCCGTAAACGAGTGTTGGCCGCTACACTACACAGAACTGATTAATGCGTAAGTGAAAA
CGAGATATTAGCGCACGATGTACTTTTTTTATGTATGCCACTCTCACGTATTGACTTTTTGACCTTCCACTTTTTGCTCATGATTATCTCTGGTTTGGAG
GTACTCGATAACATTTTCTCTCACTCTTTTACGATTTGCATGTATTTTACCTCCACTATATGAGTTTATAGCAATCCCGAAACATGGAGATATTTATTAG
TGACAGTGCGCAAGGTAACTGCAGAGCCGTTCAAACCCTACTTCTGTCTGTTGTTGTGTGTCTGTCCGTAAATAATGCTAGGTGTACCTTATACTTCGTA
TTAATCCCGATGTAGCACGTCGTCTCCCCGTATGTAGATATGCAGTATATGTGTAACTTGTTGGTCAGGACAGTTACCGCGA