Description :
From Genome Similarity Track
Location :
Scaffold_1:732036- 733162
Sequence
1126 bases(100 bases per row)
GTGGGTCACCTGATCTTGTTCGCACTGCAGCAATTTGTTCGCGTCGAACACTCCTGCGAAAAAACTAGCGTCATGTAGCAACCGTATGATACCGTTGACC
TCGTCCAGCGTATCAGACGCTACTGCCGGTGGGGTATCGGACCTTGAATCTCTCCGATCAGCTTGGGCTTCAGAATATGGAGCACTGGGCCGCTTGATAG
CATATTATTGAGTGTCTTCGAGTGATATCCCTTCGCCAACTGATCTAGCTGCCAGCCTTCCATCTTCATAATTTAGTCCACGTACTTGATCGGTCGATTG
ATTAATTTCATGCTGCGATCGTGCTGATCCGATCTGGGCGCTTCTTTCTTCACTCATGCTGTCTTCACGTTCTTCGTCTTCCACTTTGCTTGAGTGGTCG
CGGGTGATAACTGTTCGGTTTTATCCAAAGAGTTTTCACCGAGCAGAACGTGATTTGCGGTACGATCCGCAATGGTCCCGGGAGAGACATCAGGAGGGGG
TCTAGGTTTCTCTACCAGATCGATCGATCGATCGATCTCCCTCTTTGTTTCTCTTGTCATTGGAGGCCCCTCCAAAACTCCGATAATCTGGAAATCCTTT
CAAATCACGCGTCTGCGGTGATCCCTCTGCCTCTGACGCTTCCATCCCAGGTTACGTCTTTATTTTCACCTCTTCACTCCGAACTCACGGTGAATTCCCG
ATTCACCAGAAGATCCGAGCACTCGCACTATTGTGGTGGAGTGGCGATAACTCTTTTAGTGAGGCGATGCCAACTCTCCACTGGCGCCCAGACGACCGAC
TAACGGAGGGGTACTCCGATACCGTGTGGATGTATTCCTTCCTCACCTTGTGTACCCGTCGGTAGTGCGGTTGCACTCTACTCGGTGGACTCGTGTCGAG
GGAAAACTTGACCGTGTTGGGGATAGGTTGGTGTGATCGTGCAGAAATCTTCACACGATCACGAGTGCACTGGTAGGGTACTTAATGTAAGTCACCCAGA
TCTCAACGAGATCGCCTTGTCCAATATGTAGATGCTTGAAACGAGAGAATTTTGACCACTTGAGCCGTCTCGCGATCTTGCACCTAGTCCTTTACGTTCT
TGCTGCGTCCAGTCGCAGTTGGAGTT