Description :
From Genome Similarity Track
Location :
Scaffold_2270:732- 2499
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_2270-abinit-gene-0.10Conserved gene of unknown function

Sequence
1767 bases(100 bases per row)
GAAGCTGCGCCAGTATGCAGCGTGTCAGATTGCAACATGCAGGCGATGACGAAGGGTGTGTGCAAGTATCACTCTGGACAAGGACAAAATACAAAGAAGC
AGCCTGTGGGGAGTGACGCGGCCACGGCAGCGGCGGTGAGTGGGATCCGAGAAGTCGAGCCAACGCGGTGCAACGTGGCGGACTGTGTCCAGGTGTCGTA
CTCTTCCGGGATGTGTCTACAGCATTTCAACCAACATCGACAGCAACTGCAGCAGCAACAACGACAGCAACAGCAGCTGCTCCAGCAACAACAGCAGCAG
CAGCAACAGATGCAGCATTATCAACATCAGCAGCAGCAGGAGCAGGAACGAGGACATTCAGTGCAAGGAAGCAGATACAGCAGCAGCGTGATCTCACCGT
TTGGAGATGACCGCTTCAACACGCCTATGGACCCGACTCTTTCAGCACGGCCCGGCATGGAGAGCTATTATCCTGGTGGCGGCGCGTATGGGGCACCGAT
GGATCCAAATATGAGCAGCTATCCACCGATGAGCAGCTCTGAGAGACACCTCTCTGGACCTGGACCATCGGGTGGTGAAAGCGAAGCCAAGCAAGCGCTA
TTCAGTCTCAATGCGAAGCTGACTGATCCCGGACGAGCCTACAACCCGCACGACGAAGGTGGTGTGTATCGAAGTGGCTCGGTGTGCAGCAATCTGATTT
GCAATCGGCAGACGTATGGCCGCGAGTACTGCGACTCGTGCCAGAGCATGGTCCCTCCACTCGTCGGCGATTCGCTATCTGGAGGAGGAGGAGTTGGGGC
TTCCTCGTATGCCTACTCAGCGAGTGCCCAGCCGGATCCCGAGACCAGTCCACAAGGTTGGGGAGACGCAGCGCCTCAGACGAAGCTGCCGCTCGCAAAG
GCGTATGAAGTCTGCCGGGTGGGTCAATGTGGTGCGATCGTCCCGAGCCTCGCGAATGGAGGTCTCTGTGATCTCCACTTTCGCTCATTCGAAGCCGGCG
ATCTGTCAGTCGACGAGCTCATGTTGCGGTCCAAGGTGCTCGAGAAGGAAAACCACGCTAGCGCTGCGGCGGCGGCTGGCGGCAACAAGAGTCCAACTGG
TGGCAAGGGGAGGAAGTATTTCTGCAAGACTGATGGCTGTGGCAAGCAAGCGCAGCGCAAGGGTCTCTGTAAGAGGCACCTCCGTCTTCACGAGCAGGAG
ACTTCAGCGAAAAAGGCGAAAATAGACTCGGCGAGTGACTTTGCTTCCCCGAACCAAGCGAGTGCTGTCATCAGTCAGGCAACCTCGACACCCTGCCGCT
TTCCGAGATGCAGCCAGCTTGTTGGCCGGAATGCCCCGTGGCTGTGCACTGCTCACGCGAACGCAAGCTTCTGCTGGCAGCCTGGCTGCGAGAAAATTGT
CGACGGGCCCCAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGCTG
CAGCCACGAACACTGTGACAAGTTCACCGTCGGGACGACCGGTGTGCGCTGCCGGCTTCACCAGATC