Description :
From Genome Similarity Track
Location :
Scaffold_3001:732- 2260
Transcript NameFunction/comments
Phypl_g15547hypothetical protein PHYSODRAFT_336537
Phypl_g15548hypothetical protein

Sequence
1528 bases(100 bases per row)
ATAGAGCGAGTCGATGCCATCGCGTAGCAGAGGCCCGTCTCATCCGTGTTGAAGatgtccttggcctcgtAGAGATCGGTTAGCTCCTGTAGTTGCTGTC
GGCCGAGCGCAACTACTGCTGGATCACCTGAACCAGCTTCACCAGGCCGCTCACGGTAGCGCAGCGCATGCCTCCGCTCAAAAGCAGTTAGTCACCCGTC
TGAAAAGGAGAGCTCCCAAGCGTCACATAGCTCCCTCTGTATATCACGTGCCTTCACCATGATCCATTCACGAGAGAGACATATGCCCTGGGACTCCAGA
TTCTGTATCCACGCCCAAAGCGTGTTCTCCAGGGCTAAATACGTCACGTTCAGGGGCTTGCGCCTGATTCCGTCGCCGtagtcgtcgctcatgatCTTGG
GGGCTCCCTTGAGGATGTCTGAGACGGTCGTCTGAGCAGGGGCATGCTTGATCTTGAAGGTCACCTTCGCCCACGCCGCTAACTCTTGCTGCGTCATGGC
TGGACAATCGGCTGCTTTCTCGATGAGAGCCCTCTTCTGCTTGATTTTCATCCAGCCTCCCATGGTCTGTTGGTGCTCCGATTGAGTTCTGGTGCGTGGC
GAGCGGCTAGGTTGCTCCGCCGCTCTGCTGAAGTGCCAATGGCTGGTGCGTATGCTTCGCAATGGCTGGTGTGTAGTGCTTCGCGCCAAAAGTCCCGCCA
AAACCATAGAGCCTTTTCACCTTTCTAAAGCGATATTATCATTCCGTTCAGGGTATTCATTTGTAGCAGTACCGGAATCGAGCGCACTTACTGTAATTGG
CAGACTCCGAACCAGAATCCGGACGCCACCATACGTTTTGACTGGAACACATGATGAAAAAAGGCGCCCCATCCAAATTCATTATTCATTCCGGACATCA
GTGAAATTCGTATTTTATCTAATCTAGCGACTAGTGGTAGGACAGCGGCGCTGTGGGCAGCGGCATAAcggacggcggcaccacgggCGGTAGCACGACT
GACGGCGGCATGGCGGACAGCGGCACCAAGGATGACGGCATGAggggcagcggcagccacTGGCAGCGGGGGAGGGGCAtgagcagcggcatgacGCACG
ACTGGACAacgtacagcagcacgactGACAACGTCATGAGAGGCAGCGGCAGTCACTGGCAGTGGGGGATggcacgacgagcagctttATGATGGACGGC
GGCATGACTGACGGCATGACGGACTGCCACTTACACGACGGGCAGCGGCATCACAAACGACGGCACCATGGGCAGCGGGGTGAGGCACGACGAGCAGTGG
CATCACGGACAACGGCGCTACGGGCAGTGGCACAACGGCTGCGGAGCGGCGTGGCGGGAGTTCGCCACCGCCCCGTAGAAGAgtcgcccgccgccgactt
CCAGGCCAAGATCCTCATGGAGATCCCCGCCCATATCCGGTACGTTAATAACAGGATGAAGCCAAAGTAATGAAAATTGGAGGCACTGACGGTGTGTTGT
TTGTGGTGTTTGACAGTCGAAGCCTTCG