Description :
From Genome Similarity Track
Location :
Scaffold_329:732- 2130
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_329-snap-gene-0.19Conserved gene of unknown function

Sequence
1398 bases(100 bases per row)
ATCGTCCGGCGGCTTCCGGAAAACAGTTTGTGCGGCACGTTCGCGTACTGACTGCGCTCCGTGGCGCTCGCGGGCCGTACGACAATCGGCACCTGCCATC
TAAACGTTTGCCGCTGTGCTACGTTGTTGTTGTTCGCTGTAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATCCACTGGAAGCACACCAGGTCGGTGCGGATGCTCGGTAGCGCGTCCTGTGGGATGCAGAAGCGCACNNNNNNNNNNGTGTGCAGCACC
GAGCCCGTATATTCGTGGAACGAACCAAATTCTCTCGAGTGCACGACGCGCGACGGGTCCAGCGACATGGACGAGAGCGTTTCCTCGAGACACAGCGTCG
CCGCGACCTCNNNNNNNNNNCACGGCGCGTGAAAAGTCAAACACGCCAAGCAGGATCTCACCTGGCTGGAAGAACTGCTTTGTGAGCAGAAAGCGTACCA
AGTGGCTGCTGTCCTTCCCGATCGTAAAGATGCTTGTCTGCGCGCGCTGCATCGCCTCGGTCTCGACGCGGCCGTGCATGAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAACGGGATCTCGTTGCCCTTGCGCACCCCAACAGGGATGACGCCCACCGAGATGCTGCGTTCTTTGCGCAAGTTGGACCGCTTTG
GGCTTCGATCTCCTCTTACTGATGACGAGGGTGACGCTCCTTTCCCATCGTTGCCATGCATTGCGGCATACTCATCGGCGCCTTCGAGCGTCGTCGNNNN
NNNNNNACTCGGATGCATACACTTCAAACGGGAGATGCACTGAGAATGGCGTGCTCCCTTCTTTCGCGCCTTGCGCCGTGATCGACAGCACGTAGAACAC
GCGCGCAGCGGTGCCACGGAACGTCGGACACGCGACTTCTGGTAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAACGCTTCGCTGTCT
CATCCTTCCCTTTAACAACACCTGCATCCGATGGTGAAGATGCCGCTTCCAGCTCCTGCTGCGTTGGTGCAATGTTGATATCCGAGAGCAACGTCGTTGG
CACCGACTGGTAGATNNNNNNNNNNGCCCGTGTCTCCCGAGAAGGTGCGCACATCGGGCAACGCGCCGCTCATCTTCTCAAAGAAAAACGCATCCTGAGG
GACAGCAGCGCCCGCGCCGCTCCCTGCACGTTCACGCTCAATCTGCGAGGCCGAGCGTGGCGACAGCAGCGGCACGACTGGCNNNNNNNNNNGCAGGTTA
CTGTCGACCGTCACATGCGCGTGGATCTGCGCGACGACGTACGCGATCTCAGTCGACGCGTCGGCTTTTTCGCGGTCGGTGTGCAGGTTCACGACGCC