Description :
From Genome Similarity Track
Location :
Scaffold_344:7319- 8730
Sequence
1411 bases(100 bases per row)
CCCTTCAAGGAAACAGCGTCTGACATAATTACCGGACACTCCGGAGTCGATCAAAATAGACCAGGGATTGTCAAAGCCCTTAACAGTCGCCTTTGCGACC
AACAAGCATGGCTTGTATTCACGTCCCGTGTTAAAATGCACGGGAATCCTTGGGGCTAAATTCCGCTCGCCATTACCTCCTGGAGGCTCAACAGAACCTA
GTTCTTCCCCAGCAGGGCGCCCCGCGCCTACTGGGAGTCTACGTTTTCCCGCACCGTACCAGACTTCTGGTTAGCGGCGGGAGTTTGGCCTGAATTAGCC
TGGCGTGCCCTGCGTGAAGGGCATTTAGGTCGCAGATGCTTTGTGATTCCGCACGTGAAACATCGTCGAATGTTTCGATGCTGTTCTACAGCTCGAAGCT
CTGCTTCTTCGTCCGTTCCGGCGATACTGAGGCCCATAGGCTCCGGACTATTAAATGAACTAAAGGAGTTCGCGGAGTACGGGTTGTACCCATGGGTGCC
AAAACGGGCTGCCTTAAAGTTGAACTCAGCGTTCAACGCGATATCCACAGCCGCCTCAAAGGAGGTGGGGTGTACCTGTAATACTTCCGTTTGAGCCACG
CCCGTACGAAGGCCCTCCATGAAGATGGTAACCAAAACCATTTCTGGTAAGGGATCAAGCTTCATGGCCGTGATTAGAGTTCTCAGTTCCTGGACATAGT
CCGATAATTTTTTCTTGCCCTGACGGGCAGATAGGAAACAAGGAACGCACCCGGTATGCCTGATTAGGCGGATCAAACACCCGGGATATTTACTGTTTTA
GCAAATCCCACGTGGGAAAAGCTTCGTCTACCGACGAGCTACACGTGATAGCTCATTCTCTGGCTCGACCACCTAGTTTCGAGATAGCCATCCCAACTCG
CTATTGCTCCGACCGGAGCATAGCGGAGTTCGTGGCCATTTTCACCTCTCTGGTCCACAGGAGGAGATTCTCCCCTTCTGTTCCCTCAAATGCCTTTACA
GTCAAGACAAGGGGGCGAGCCCTTGGCTCTTCATTAGGTACGGGGACATACCGAGTAGGCATAGCCGATGCCAAATGGTCGTGTACTTGCCCAATCAAAG
TGGACTCAAACTGCATAAAAGCGTCAAGACGTGCACGAATCACGTCAGGACCTTGTGCGAGAAGTAAATCCACTTGTTTGCTCTCGACTAGCGCTCTGAG
TTTCTCCAGCGCTAATCCTTGGGCCTCAGAAAGGGTTATCTTGGTTTCCATCCTTACAGTGGAACAGTCTTTAACAGACTCAGTTGTAGATTAAATACAA
GTGCTAACAAGTGCAGCGGAGCTACCCTTACTCCTTTGTCAGAGGAAGACTTCTAGACTCGTAGAGTCTCTCAGTATATCAAACTAAACGGGTATTGACT
TAAAGGGTCTC