Description :
From Genome Similarity Track
Location :
Scaffold_114:73181- 75863
Transcript NameFunction/comments
Hyaar_Emoy2809953sensor histidine kinase
Hyaar_Emoy2809954Uncharacterized protein C14orf138, partial
Hyaar_Emoy2809955hypothetical protein

Sequence
2682 bases(100 bases per row)
ATTTTGACCCGGACAAGGGCAGCGCGTACACGTTCGGACGTGTCCCCATGGGCTCGTCCGACTTCTCACGGGCTTCGTACAGTCTTGATGACGTGGTGAA
CGACACGACGCTCGTGCACTTTGACCACGACGTGAAGCACGACCAGGAAGTGCTGATCCCGTTCATCCAGCGCGCGCTCGAGCGGCAGCCAGCGCTCAAG
TTGTTCCTCGCGCCCTGGAGTCCCCCGGCCTGGATGAAGCGCAAGGCGACCAACTACGTGCCGAGTATGCTGAACTCGGCCAAGCCCATTGGCTTGAAAG
ACGACGTGCGAGCGACGTGGGCGCTGTACTTTTCCAAGTTTATCACGGCTTACAAGAAACACGGCATTGCGTTCTGGGGGCTCACGCCACAGAACGAACC
ACAGGCAGAGGTGCCGTGGGAGTCGTGCATGTACACGGCCGAGTACCAGGCTGAGTTCATTGGAGACTTCCTTGGGCCGACGCTCGAGCGGGACCACCCC
GAGCTCGTGCTGATGGTGTTCGACCATAACCGCGGCAGTGTCCATCAATGGGCAACAGAGATATACAACCACCCGACTGCCGCTCAGTACGTGGACGGCA
TGGCTTTCCACTGGTACGACGAGCAGCGCTACATGGATGGCGTCGAGTACCACGAGCGCCTGAACGACACTCACTTTGTGGATCAAAACCGCTTCATGTT
GGCCACCGAGAGCTGCAACTGCCCTGGTGTGGCGCACGGCGACCTTGCGTGGTTCCGTGCGCAGCGGTATGGACACGATATCATGACGGACCTGAACAAC
TACGTGGCTGGATGGGTCGACTGGAACTTGCTGCTCGATCACGAGGGAGGACCCAACCACTTGGCCAACAAATGCGACGCCCCCATCATTCTGACACAGG
ATGGCACCGACTTCTACATCCAGCCCATGTACTACTTCATCCAGCACTTCTCCAAGTTCATTCCTGTGGGCTCGCGCCGTGTCAAAACGCAGGTGGCAGC
AAAGTTTACTCGTCCTGGTGATCCGCAATTGTACGTGGACTATCCATCGATGCTGGCAGCTTGCGATGGCAGCTCGCGGCAACAGTGGCGGCCGACAGAT
GATGGCAAGCTCGAGGTGACTGGTACTGGCTTTTGCATTGATCTAAAGGAGATTCCGTGGCAGGGACACCAAGGTCTGCTCGTTGAGTGCAGGTACACGC
AGCAGCATTGGACGTATGAGCTTGACACCGGCCGCATTCGTATGGGGGATTACTGCATCTCGCTGAACCACGGCTCAACTGAGAATGGCGTGCGCATCAG
CGCCGACTTGTGCGAAGACGCGGTCGTACCTCACCAGCAGTGGAGGTTCAACGTCGAAGACGGTACCATGCGCTCATTCGCGTCCACGACGGACCAGTGC
GTGACTGCCGGCTATGCGTTCGTGCAAGCCGCTGCCTTTGTGACTCCAGAGAACCGCAAGGTGCTCGTGGTGTTGAATGAGAACACAGAGCCAATTGATT
TCGAGTTGCAGGTTAGTGGTAACGCGCTGCAGACGACGGTGCCTCGCGGCGCCATTCGGACGTTTACGTGGGACTAAGGCGACAGCGGTCATAACGTAGC
TTGCTAAGGTGGTCAAAGTGGCCGTGGTAAAACGCGCAGGCGCAAAAATCAACGTTAACAACATGACAACCAAGTCAGCCTCACGGATGCAAACAATAAT
TTGGGCTGCACCTTGCATGCGCCAAAGAGCGTCGAAGGTGTTACTGCAATCGTGGACGTCAACTTTGCTTTCATCTACAACGGATCAGATGACAAGTCTC
GCAACAGGTCGTTCCACCTATCGGACGGATCCGCGTCCTTTTCATCCCCGTTCAAATGCGGACCCTTGTCCGGGTCCCAATCCTCAGGAATCACAATTTG
CATCTCCAGCGGCACGTGGCGCTTCTTGCGTCTCAGCTCAAACACTTCAATCGTATCTTTCAGATACTCGCCATCCAGCTCTTCTTTCGGCACTTCCTTC
CACTGGAAGTACGTCTTCAGATAACGCATGAACTCCGCTCGGATCTCCGGTGACCGCCGCTCATTCGCCACGAAGACCACGGTCTTGCGATGCGAAAGAG
TCAACAACGACTGCACCAGCGGCTTGACACAGGCCTTCTCGTACACGACATCTGCACACAAGATACAGTCAAACGGCGCCTTCAGCCTCGCCACTGGCGT
GCCCCTGCACCACAGCACCTGTCAGCATCTTGTCTCATTGCAACAACAGTTCCAATAAGTGAATGCATCCAGAGTCCACACAATCGCGTCTCACCGCACC
AAGCGTATCGCTCGACTCGGACGCGCTGTCGCTCCTTGTCCGTCAGATTCGCTCTCACATTGCGTCGAAGCCACGGGAACACCGGTCCAATGTCCGTAAA
CACCACATCTGCTAGTCCACCAGTGACGATTGCACTGGAAATGCCCGCGAGACCGCCACAGCCAGCGCCTAGTTCACAAATGGACGTAAAGCTCCGGAAC
TGTTCGTGCCTGCGCTCGATGAGCTTGAATAGCGTCTTGCTACTGTCCCAAACAGTGGTTCCCAGAACAAACGAGTCCGGGTCCTGCTCTATGGACACGA
TTCGGGACTCACCAATGGGCACTTCCACATAGCGAGCCCAGTGTGTAAACGAGGCTTCGCGCGCCAGCGGCTCGGATGTCTC