Description :
From Genome Similarity Track
Location :
Scaffold_6:73180- 96344
Transcript NameFunction/comments
Phyta_totarag452tRNA wybutosine-synthesizing protein, putative
Phyta_totarag453hypothetical protein
Phyta_totarag454hypothetical protein PHYSODRAFT_474162
Phyta_totarag455hypothetical protein PHYSODRAFT_470887
Phyta_totarag456conserved hypothetical protein

Sequence
23164 bases(100 bases per row)
AATGTTAGATGCACAGAATGGTACTAAGCTGGCGAAATGGGCACGCAGTGGATGTCAGCCACGAGGTGATACACTTTTGGGGCGTACGACTTGACCTTCT
CCACGTGTTCGCACGTGATGGTCCACTCCTTGCCGAACTGCTGGGCGAGCTTGCGCATCGAGTCCAGCACGCGTTGCTCCCATTCTTCGCGGTCCTCCAC
AGCCACGTTATCGTGCACGTGGAACCAGCCCCCACTGGGTTTCAACACTTGCACGGCGAGCGGCCACGCCTTCTCACTTGTGGGCAACAGACCCAGATTC
ACGCGGTCGGCCACAGCGCCGATCGTAGGAGCAGACTCGCGGTTGTCCCCGAGGTACACCTTGCATCTATCTGTGACGTGGTTGCGCTCCAGGTTGAAGC
GCAGTGCTGCTACCGAGTCCGGGTTCCACTCGCAAGCGTGGACGaatgcagcaccaccatgcACGAGGAAAGGGAGGACGTAGTAGCCGATGCCGCAGAA
GAGGTCGACGATGGTCTCACCGCGACAGCCGATGTTTGCCATGCGGGCCTTCTCAGTGACATTGCCCGACGAGAACATGACCCGTGTGAGGTCCCAGCCG
TAGATAATCCCATTTTCACGAATTTCCACCCAACCGGGGGCCCGCTTAGTACGCTGCGAGGTAAGTACCTTGTTGTTCAGGTACAATAGCTCCATGTGAC
TCTGACGCTTCTCGCTTGAGTCAATAAAGGCTTTTCGTGCAACACGAGAGAAAACGGGTGTTGTGGACGCACAAACGTGTGCCCACATCTCGTCAGCAAA
CGGAGTCCATTCCGGCTCGAGGAAGGAATCGCGCGGGATTAACAAGACATCGCTCACAAACTCATACTTCTCCGGAATAGCATTCAAGAGTTTAGGCGAG
AGTTGATGCTTGCTAGCAAAAGCGCCAATTGCACTGTGGATCACTTCGTTGCGGTTCAGCCCACTCGTCTTGCCGAACTTGTTTGCGTACGCATCATCGT
CATGTACAATCTCAAGCTTCTGCACTTCAGCGTCGTTCGTCGAGGCAAACAGGTCGCGAATAGTTGCTGTTACTGGAATCAAAAACATCGTCGTAGGCTT
TCCGTCAGTCGCAGCCTCGTTCGACTGAGCAACATTTGCTATGTGGACACGTCGGGTCTTGTCATATACGTgtgccttctccagcaatgtcttcaccttc
ttcacttcCAACTTTCCGACCAAAACACCGAGCGGCTTATCATCTGATGAAGCCGACACACTTGTAGACAGTGCGTTGACTGGGTTGCTCTTGGCAGCAA
CGACAGGGGCTGTATTCGGCACAGGCAACGAAATGTGGCACTGGTACGTCGACGAATAATACTGTCCAAAGCCAAAGCATTGAAAGCCACCGCCCAAAAT
GTAGAGGGCATTGTTGGCCGGCATCCACGTCGTGCTGTGTCCCACAAAAGCTGCATTCTCATGCTTGACTTCGCCAAGCTCCGTCCATTGTGACGTCTGA
ACGTCTAGCATGTAAACTTTTTGGGTCGCCTTGTCTCCATTCGCAAGCAACACAGACGTCATGCCACCCACCACAAGTACCTGGTGGCcgttgattgagg
aagcgctggcAGCAAAAAGCGCAGGAGGCTGGCTTTTGTTCCTGGTGTTTTCGAGACTTTTGTGTTCCCAAGTCTCCTTCACAGTATCGAAAAGCAAACA
CACGCCACTATCATCTTTGTCGCTCCAATCACCAGTCTCCAACGACGACATACCTCCCCAGAACGCAAGCTTCGTTGATTTGACAACCGCACCAATGTGA
TCAAATCGACGTGGGATGCTGGACGAACTCTCTGCAAACGCATCAGCACAGGACACGTTTAGTATCAGACACTTAAAATGTAAGCGCAGATTTGGAGATT
GAGGCGCACCAATTTGACGCCACTGCGGCGGGTTTTGGTTGAGATCCAGGGCAAACACGTCACCAAAGACTTGCTCGGCATCGCGACCACCGTACACGTA
CACAACAGAACTAACTGTAGTCACATCAAGGCAACAACCAACTAGTAATTAGTACCCCCTCTCAATTATCAGCCTCACACCAACAAATACCTGGCCAATA
AATACTCACCAGCACAGCTGCAATGCTTCCACCGCGGAGAGGGGCCAACCCCTTGCGGAACGATCTTCTCCCACTGCTTCGTCTCAAGATCCATAGTATA
GAGATCTCCCAAAGGTTTCGCGGGGCTAGCGCGACCACCAAACACGATCATACGCGTTCCCACAACAGCAGATGAATGGTACATCCGAGCCAACGGCCCA
TCTACCCCCGCCGCCGCGTAGTATGTCTGCTGAAGAGAACCGTCCTTGGCAGGGGTCAAGAAAGTCACATCGGCAATGCGTGTGGTCGTCCCAGAAGCGG
TAGGTCCCTGACCACCAAATACCACAATGGAATCCCTGTACTGCACGCTCGAATGTCCCAAAAATTTGACGCCATCCTCGCTGGTAACCTCCGTCCAGGA
GCTCAGTTCAACCACAGACCTGCTTCCAGTTTGCGAGTTCGCTGCCGGCTGGCAAAATTTGGCACGGAAGGCCTCAACAAGTCGATctgtcttctgcttg
ttggcTTCAAACTTCTGGTTCGCGATATTCACGATCCATTGGAGGTACTGGTCGTtgaccagcaactgctccGCACTGCGTCCAAGTGGGATTTCCAACC
CGTTGGCAGTCGTACGAATCGCACACATGATCTTTCGGTTGCCAAGGACGACGCCCGATTCCCGGAACCCGCTTGCGATACCCCACTGCAACATCTCCTT
CGCCGCGTCCAGATCGCGACACACGACGTGCATGATGAACGGCTCGTGCTTGAAGATAAtctacaacagcaacaacaaaaaacacAAAACAAAGTTAGCA
ATagcaaaaaaaacacaaGAAAGTAAGAGTATAACTATCAGTCCACACACcatgttgctggtgctcgaaTGGGCATCAGGCGAGCgcaacgccgccacca
aTTGGTCGAACGTGACGGTGGCATGCTCAGCGATCAGCCACTTGCCGCCTTTGGTGATCAAATCCGAGCCAACTTCATTCCCATTGCCCGTTGCAGCTTC
CCCGCAGAAAACTGCGATGCGACCcgaacacgagctgctcgtcaccTGTGTCACAAAACCCAAACAAGTGAGTAAGGCAAAACTCTTTCTCCACTCTCAA
CCAGCACCAAACTCACATAATCCGGGTGCGCATTAATGGTCCTGATCATCTCCACGATAGGTTCGTCGATGCAGCCCTTGGGACTCTTGTCCTCCatcgc
ctgcagcttgcgcagaCTCTCACGCTTGAGCTGCGCGAACATCGTCCTCCAGTCGTCGAATGACTGACGCACTCCAAACTTAAGTCCCATTCAAATATAT
AGTACCACACAAAAgtagtttttttttgcttcCACACAAAAGGCTATAATTGCTATTTGCTACTTCATCATGGCGGAAGATGCGCCGCCGAATATCCGCG
TGAGCTGCGCTGGCGTGCGCTCGAACCAGCACAGTTCGCTGCCGTCCGACCACGGCCGCGTGTTCTTCAGCGAGTTGCAGTACGCCCAGTCCCCTTTCCT
CGTGCGCGTGAGCTTCGACAGCGTGAGCTTCGTGCACCGCGGGACGCACGTCGTGGAGCGGCGTTTTGTCTTCCCAGGACGCGTCCTGCACGCTGTGCTG
GCGGATTTCTCCGCGCAAGTCTTAGATAATACAAAGCAACCTAATAATGGGTTAATGAGGGCTCGAAAGCCGCGGAACTCGCCGCTGCAGCCCCAAATGC
ACCCTCATTTGTGCGTCTTGGTGCGTTCCGACTGCTTAAATGTGTACTCTGCAGCCGGAGAAGTGTTCGAGGTGGCGCTGCCCTTTCAAGCCAATAGACT
TTTCCCCATGGAAGGGTgcggcctgctgctgcaacgcagTCCGGCGGTACAGATCCCGTCCACGCCGTCGAAACGACCGagagacgctgcagctgtggcg
ctggccagGAAGAACCGACGAGCGAGCACGAGCAACagaggagatggagacagACACAGGTACAGCTCCGCGGAGACAGGCGTTCCGGCGAGACCGAGGT
ATTTCACACTCAGACATCCTCTGGATGAGGTCAAACCGGTGGCTTTGAGTTCGAGCAAAGGGAGCATGACAGGGAAGAGTGAGGAGAAGTTTCTATCGGA
CTCGGCGTTGGAAGCTGTGGCGGTGTTGGAGGATGGGAATTCGCCTGTTTTGGTAGCTTTTCATCGCTGGGAACAGAGATTTTGTGTTTTTCGGGTGAAT
GTGGTGGAGACGAAAGCGACGAGTTGTTGGATGCCGGAAGTTAAAGTGGTTGATGAtccgacgtggacgagataCCGTGCTAGAAGTGACTTGGAGGAGC
TACGGGTGCGAATTGAACCGAAGTGGATGGCTACGCCTCTGTGGAAATCTCCACGAGTTGGACCAGCGACTTCGAAGCCGATGTTTCTGTCGCCGATTGT
CTTGCCTCCTTCTTTCTTGACTGCTCCACCTGTTCCACCATCACCGTTAGCGATCAGCTCATCGCCGATTTCGTCGGGAAATATTACCAAGGTGGCATTT
ATCGGGTCAGGTGTCGATGGCCTCCCGCTGCTGTGTATAATGGACAAAGATGCTGGAACTCTAGTTTTGAAGCCCATTTCACAACAAGAAAGTActgcag
atgaaggcgacaATGAAACTGGTGGTGTTCGCATCTTGCATTGTCGTGACGCTGTTCCTATATGGCAGCAAGACGACGTAAGATCTTACGAAGGTGGAAA
GGACCTCAAGGGCCATCGCTTTCAGCGTCCCATTGATATTGTGGTGCTAGAAAAGGATGGGACGCTCATGTTGTATAGAGCTCACCATCCAGTTTGCCGC
CTGGTTCTTCCTGGTGTGAGGCAGGATGATCTGGCAATCGGCGCTGTAAACAAGGATGATTCGGAGAGAATGCGGCTGGTAGGCAACGTTCAGTTAAAAT
CTATTGACAGAGGCTACGCTTACGAGATCATGTTCCCCGATTTATGCGGTAACTGGAGCGGGAAGATCTGGCGATGCGAGCATCCGCTGAAGGTTGTGAG
CTCTCCGCTGCTACAGCAAGTTTTTGATGTACTGGATTGCATAGTTCCACCTACTGTGTTGTGCGCGTTTAGGGCACAAGTGGTTTGCTTATCGCAGCAG
GAAGCTCAAACCACTTCAGAAGGTGACAAACTCGCGGATGGTGGGCTCGAGTGGCAGTCTTTCTGTGAGTGCATCATCGGTCTGCTGCCGAAGCAAACCA
GTGGTAAAAAGGAAATGTTGTCAGCCGGAACAACCagagatgacgaagatatggctgctgctccttcgtGCTCGTCATCTTTCGATGCACTTTGCCAGAG
TGAATTTCATGACATATACCAATATGAGCATGCAATGCTTTTCGCCACAATGGAGCTGCCTGTTACGGAGTTCTTGACGTACAGCTCCAGTGGTGATCGA
GTGAATAACTCCGAAGGCATTCAATTTAACGAAAAGCGGGGGAGTTCGAGTATGGGAAAATACGTGATGACCATATTTTCGGGCCTTCACTTGCTGTGCG
AAGAATTCAAGTTGTCAATCACGCTCTTTCAACAGCGATTGCATCTAGCGGGCTTGCTGTTGGAAATGGGATTGCAACTGGGTTTGGATCCTTTTGTCGC
TTATTATAAAGAGGATAACTGCGTCTTAAAGCACCAAAAGAGTTTGACGGGGGGAAGTTCTACGTTGGGGTTCCAACCGCAGAGGCAAGCAGAAGGATTA
CTTTGTTTTACCGAGTATGGGTGCGTGCCTGACTTGACGTTGTGGCTTCAAGGCAAGATGACAGCAAAGTCACACAAATTAGTGGAGTTTCCCGCGCTTT
TTGAGAATtcagaacagcagcagctttctGTCGGTTGCTTATTTCGACGTCCTGAGAATCCGCTTCGGCGCACTAGAGCGATTTGTCGCGTATACGAGCT
GATGTTTCCAAGTTCTGTTTCTCATTTGCCAAGCGCACAGTCGAATGCAGTCAAACTGATTGTTTACCTCACTCAAGACCCCATTGGTAGCGCACTGTCG
CTGGACGATCTTCCGGTTGGTCTAAGCTTTCCTATCGTCCAAACCATCCGCCAAGTGAAGCACCACCCGCCTCCTTTCATTACAGAAGACATCTGTGCGT
TTGTTGGGCGGGAAGATCTCAGTATTGCAAGCGCGGAAAACCTTGCCGACCATTTTGATTACTCTGGTGTTGGCCAAAACCAACAACAGCATGATCTTGT
TAGCAAAACAGCAGATCCGGGTGCCCAAACCGAGGATGAGAGCCGCGATGGCTGTGACGGTCTTGAAGACATTATAGTTCGGAGTCAGCCACTCTTTCCT
GCCGATCAGAGAATGAAGGAGGTTGCACGACTTCTTCGTTCAAGTCGCCCTCTCTGCTTGAAATTAGAGAAGACCCCAGATTTGTCGGACCTTGACTatg
cgcagcagcagcaagctcgaTTGCTGCTTCTCTGCAAACGATCTATGGCGCTGTCTGTGGCGCGCGGCATGGTTACACTTGGCAGCTTTGATGTTTCTAC
TGCTCAGACACAAATATGGCGACTTCACATTCCTGCACTACTTCTTGCTGGCCGTAAACCACCGGCAAATGCGATTGTGGAGCTCGATCTGTCCGGGTAC
GCCAAAGAGTTGACATATTGGCCTCAATTTCACAACGGGTGCGCCACAGGCCTGCGGCTTCCAGCACATGATCTCTCGGGGGTCATTAATCGCCACTGGA
TCAAATACCATCGGCCTTCGGTTAATGATATTCCCCAACGAAACTcagctggaactgctggGGGCCggcaggcagcagcgactcagTCAGCTGATGCTGC
CATTCGCAATCTTGAAGAGGCGTATGCAGCTCACGCGGGATTATTGCTGGGAATAGGCCTACGCGGTCATCTCAAGTGCTTGTCCATGGCTGATGTATAC
AACTACCTGTCGCTGTCGAATGAGTTCGTAACTGTTGCAATCATGCTCGGCATGGCTAGTACGGCTGCGCACTGTAGACGCAAGCGAAAGgagcaaacag
caacagcgaaTCCTGTCACCAGTGATGACGAGAACCAATCTCCACCATCGGCAAATGAAGGCGGTGAGATGCCATCACTAGAGACAGATCACTTCTTCTC
CGGTTTCCATGAGGTTCCATCGTCCGATAAAACTCCTCTACTTGGAACGGGGTTAGAGTTGGCGTTGGAGCGATCGGTATCCAAGATGTTGTGTCTTCAT
GTTCCGTCATTGCTACCACCGCCATTCGGAGGGTTTTCAGTACCTGCATCCACCCAGACGGCAGCATTACTGGGACTGGGCATCTTGTACCAAGGCACAG
GTTATCGTCTGATGACAGAGCTGTTGCTCACTGAGATAGCGCGTTCTCCGTCGAGCGGCCAATTTGTGGGAAGCAACAGTAACGCGGGACTCTCGACGGC
TTCGTTTGATCAGCTGGAGGGTTATGCTTTAGCAGCAGGAATggcgcttggtcttgtcaTACTTGGGCGCGGCCAGACCACTTCAGGAGACCCTGGACTA
GCCGACTTAAAGCTAGAGGAGAAGCTTCACAAGTACATTGTCGGCGGTGCACAACAGTACCGGGACACAAATGCGGTTGGAAGCTGTCTCTATCGCGGTC
GTCGTTGGCAGGCGTTTGGTAGTGGGGGCAATGGTTTTAACTCTGCGGTTAATGGTAGTGCCACTGGCAATGGTACGCCCAACGGCAGTACGGGGGCTTC
ACCTGGCGCTGGCCGCGATACAAAACACTCAAGTGACCACAGTGGggttcgtggtggtggcgaacATGTAAACATTGGAGTGACTGGCTGCGCAAGCGCT
TTGGCGCTAGCgttcatgtacatgcagACCGACAACAAGGCTGTGGCTGCACAGCTGGTAGTTCCAGACACACTCATCCTCCTGGACTACGTTCGTCCAG
ACATCCTGTTAGTGCGCACACTGGCAAAGAACCTGGTGATGTGGAGTAAAATATCACCGACAACGCAATGGATAGATCAGCACGAAGTCCCtgcacagct
tcttcaagtgTACAAATCTATCCAGTCACATGGGAATGATGCAAGTGGAGATACAAATCGAGTGGAATATCCCAGTGGATCGCCATCACATTCTGACCTC
CACTCAATTTGCGAGGCTTATGCGAACATTGTTGCGGGGGCGTGCTTGAGTATTGGGCTGCGGTTCGCTGGAACAGGCAACACGTCAGCTCGTGCCACAC
TTCGCAAGTACGTTCTACACTTTCGTGAACTACGAGCGAagtcttcctcgtcgtcatcctccaTGATTCTGCGTGGAAGTAGCaacgttgttgctgctgc
tacggaACGCGCGACCGTCGAACGATGCTTAGCTGTGTGTGCACAGTCACTAGCTTTGGTTGACGCTGGAACGGGTCACGTAGAAACACTGGCACTACTG
CGCTCAATAACGTTGCGGCAACGCGTGGACGCGGCAATGAGCTACGGCAATCACATGGCCCTGAGTATGGCGATCGGATTGCTGTTCCTGGGCGGTGGGC
GTGCAACTGTGTCACGATCTAAAGAGGCTATTGCGGCACTCGTGATCTCCCTCTACCCGATGCCTCCTATGAATACGGCTGACAACAAGTATCATCTGCA
GGCTTTCCGTCATCTCTACGTGCTGGCCGTTGATACGTCACGATTGCTGGAGACCGTGGATGTGGATACTAAGACGACCTGTGCTGttcaagtccaagtc
gaccttcttcctggcgaaAATGGAGCCTGTGGCTCTATAGACGAGACCCAACCTTCGTATCGAGTGCAGCAAAGTCCATGCCTTCTACCGGATATCACTA
CCATCAAACGCCTCGCTATATATGATCCAGAATTCTATCCGATTGAAATTCTTACGTCGGCATCGCCCGACGAACGAGCCTCTTTGGAGACTAGCAGAAT
GAGAACAGCTAACTCACTGCGATTAGATCTCTTGCGAAACAAGAATGTGGTTTTTCTtaagcgacagcaacgaaaaGACTTTAGGGGCTTTGCGGACTTT
ACCGAGGAGCTTGAACCGCTGCATGACGTGCACGTGGGGCATCACAATGGCGGTAACAACAGTGATGATCGACTGCGGAAACTTTTTCGTTCGTACTTCA
CGAGTATTGCCGCTGACGATGATGACTGTGACGGTGGTGAGGACGATATGGGCCAGCTAGATGTGGCAGATTGGGGAAGCGGTTGGTGGTCATCTCAGTT
GAGCCTACGAGCGCTGGAACAAGTCGTAGAGGAGGCTCAGTTGCTGATGCCGCCATATCTCAATGCGTTGCATGCGCTCTttcggctgcagcaagtacCA
CAATTGGCATGTGCCACAGAGGTCGTGGATTTAAGCCTGTTCAGTGAGTACTGTCGTCTGGATATCTCGTCACAGTCAGGcatcgatgaagaggatTCTG
AAGTCGTGAATGGGTCAGGAATTATGGAGAAGAGAGCTTCATTTCCCGAGTTTGGCGTGTGGTTGTCGAACCAAACGGAGGAAGCTCTGGGTGCCCTCTG
GCATCGAACCTTGTTGGATATTACTTCGCTGGCTTCGGCACGAGTCCAGCTGCTGGTAGAAGCCACGCCATCGATGTCGCCCACAAAACGAGCTCAGTCT
GTGGTGGATGCGTTCTTCGTGAGTGTGCTTATGCGGTACTTCGCTGGTCCGTCAGTGTCGTCGCTACCGATTGCCGAGAAGCCTCGACCTGCTGACAAAG
ATTGGAAAGCCAAGTTTCAACGAGTGCTGGCCGCCTGCTCTCAAGTCCAACCTCAGTTGATGGACACAATGTCGCCGGCACGATTCCAATTGTCTGCTTT
TCTCGAACAGGATGAGCTTACGAAAGCCGAAAAGACCTTctggctgaagctggtgtcgttcttcctcttttCCAATTAGCAAGCGGAGGTAAAGATGACG
AAGGAATGACAAGATACTGCTATGGTTTTGCTAATGTTATTTGGTTTTTATTGTCTTACAGGCTTTGATCCTGAAGCTGGCtgcgtgaagatgacagcCA
TCGCATTAGCTGATCTGCTTGCAAGTGTGTTTTCCTATCTATTCACCCCGGTCCGACTAGAATGAGAGTTCAATCTTCGTCAAGGATGGGGACGGCCATC
GCCTGCAGTGTTTTGTCTTGTAGCGccttcgtcgttgtctttCGTGACCCTGGAATCATGTATACGTACAGTACGCACATGAGGCCCGTTCGCTGCTCAG
TTAGAAAGTCTGCTGACGCTCACCAGTTTCACCTCCCCGCAAGCTTTGTCCTGGTTGTTGAGAAGCATTCGCCCAAatcttcgctgctgctgctacctCT
ACCTCTTTTTTTGTGGGAACCATTTTCTCTTTTTTTTCCATGGCATGTCATGGTGTTCCTCTTTTATTTCTTTTTGCCATGATTCACCCACGCCACCATT
GCCCCGGGCACAATCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTCTTGCGCGGCGACGACACGGCTGGGGGAGCCGCCGCCAACTCC
AAGGgcttcttcaccaccttcacggGAGGTGAAGTAATCACTCGAGCTGCCGCACCATTGGTCAACGTATTGGCAGAGTTGTGGGCAGCATCCAGCGGTT
TCCCGTCCACACTACCAGCTCCACCCACAGTTTTACCATCACGGTCACGCTTACCTGTCATTTCTGGTGATGCCGATGACAccaccttggccttgagcgG
AGTGTTGTTAAGCGAATCAGTGCCGTTCGTCACCTCACCCCCGTCAGCCGCAGGATCAGGGCTCCCTGGTTGCGAAATGCTTCCCTTGCCGTTCGCCATC
TCAGTTGCAAGTGACGCTGCCTTCTGACTGCAAGTCAAATCCTCGCCATCCTCTTGTGAGTGAGTACCCTCATCACCCGAAGGCGGAGGgctcggcgctg
cagcctcctcagccttcttctcctcttccttcttcttcttcatgaactcACGACGAGCGAGGCGCGCGACAACCCGTCCGCCGATGTCTTCAAATACACT
GTCGGGCAAGGATTTCCAAACAACTGGGGTAACTCTCACATCCATGGTCGGTGTTCGCTTGTTCCAGCGGTAAAGATCAttgttcttgaagtactCCACC
GAGTTATCAATGCTCACTTCACGACTGCGCAGCTGGCGACGGTCAATATCAAAGGCCACGTAAAAGCAGACACCGAACTTACTGGGCTGCGTGGGGGTTT
CGCCGTTGGGCTGCTCGACCGCTGATGCCTCACCACCGGTCACGAAGTTCAGAGGAAACTTCTTCGTGAATGCGCGCAAGCGGCAGAGCGCCGGGTTGTA
CGCCAGAGATTCCACCAGCTTCCGCAAGCGAGACTCACAAAACCCGCACCACGCCggttcctcgtcttccttctccgTGTACACCTCGACCGCAAGGTAG
TGTTGGTGGACGGCGAAAAAGTCAGAAGGCTCAAACAGCGGCCCCCATTCCGATCCACCTTTGCTGAGCACATCCTGCACAATGGTCAAGCCACGCTTGA
ACTCCTCCTTCATCACCGTCAGACTGTGCGTCGATACATTAAACGAGGAATTCATCGACGGGTACGCCGGCGTCAGAATCGGCATCACTTGGTAACTAAA
CTCAACACCAACAGAACAGACCAATTAAACCGTCAGTCATGTAGAAAACAACAAAAGAAAAAACATCAATAATCCGATATTCAACGCACCGATTGTGGCC
CGCATTAGCGTTCCAAACCTCCAGACCGAGGTTCGCGTCGTGCGTCTTGCAGAGTTGGATGGCGAGCGGCCACTTCCAGTTGTTCAGCACCATGAAGAAA
CGCAGCAGTAATGTCGAGGGTGCCGCAGTCGGGTACAGCTGGTTGATGAAGCACACCAAGATGCACCAATTGACACCTCCAAGATACCCCATCTTGTTCG
AGTACAGTCCGCGTCTCTTGGCCCATCGTCTCACAATACGCAGCACACTGATGAAGCTCTCTCGGTTGGGCGTCAACTTGATCATGAGCTCCGTGACGCG
GGGGCCGTTGAGACTCTTCTCGGTGGCCGGGTCCACCCCCACGAGCACGTGATCGTCCAAGATATTGAGATTCTCGGGGATCGAGTTCCTTGGCAGGATT
GCAATCTGCAGATCGATGTTAATCTCCTCGTAGTCGAACGTCAGGATGGGCACGATGGCTCCCTCAATAGCCACGAGGTGCGACACCTTGGGATGTTGCA
GGAAAATGTTCTTGAGCGATGAGAAAAAGTCCTCGCGCGTCACGTGGCGCGGCGCCACGCATATGGTGTCGATATCTGCCCCTGGTTCGTTAACGCCGAG
GCGGTACGAGCCCGAGACTAAGATCTGGCCGCCGGCGTCGGCCGCCATCTCCTCGGGCACGCCCTTGTCCATGCAAACCTGCTTCACCCATTGGCGGAAA
ATGGAGCGCAGCTCGGCCAGGATCAGCGACCGCCGCGTGATGTTCTCGTCCGACTCGGTAGGGAAGTTCTCGTCCATGAACTTCTGGAGCTTAGCCGACT
GCTCCACGTCTTTGGGCTCCGGTGGCGTCGTCCGGATGGCCTTGTACgcctgctccagcacgtgcGGCGCCACGGTGAACGTCGAGCTCTGCATCTTGGT
TTGGTACGTAGGTAGGTAGTTgctgactgactgactggcCGGCCTGTCCTTCCAagagcgagcgagcgcttCCGTTTCGACCTTACCTGCTTGCTTGCGA
CAGCGCCAATCTGCTTCTGTCAATCTAAGGCGCTGTCTCTGTGTTGCTCATTGGTGGAAAAGCGTGCGTCCGTCTGTAATCTTTTCATTGGTGGAAATAT
GTGTCTATATCGACCAATCATAACAAATATCGCGTTTGAATTTTGAAAAACTGAAAATCTTCATTTTCGCGGTTTAGtatggacgacgacatcgaggcGC
TTATGCCCCGCACCAAGTGCGTCTTCCTTCCCTGCGCTACATACCGGGTATGGAATAACACACTGACATGTAGTTGCTCTACTAATGTACCCGAACAGGG
CGGCCAACGACCGTGCGCCGGTcgacaaggccaagctgaagcagttcaTGGCCATGCAAAAAGCGGCGCACAGCGTCAAAGCGTAAGAAAAAAGCTaatt
tattattattattttatTATTTACTGAATCGTTACAtttattatttatttattgTTGCAGCCGCTCGGGCGTCGTAGTGCGTGGCGACGTGCGCAAGGAC
GCGGAAGGGTTCGAGGACATCGACGACTTTTGGGTCGATGAGGACTCGATGCAGGACGActcggtggacgacgacgacgactgtgCGTCCTATTGCAGAG
CAATACAATACAACAGTAGATATATATATGGTGCTGACGCTAGTTGACTTCGTTGCTGTTTGTGGACAGCGCTGACCGTGTCGGACAAGGAGTCGGCGGA
CACGTCTGGGGACGTGTCGGAGCCGAGCGAGCAtgaggtggagctgccggaTATCGACAGCCCCCCGTCCAGTGATCGCGAGAGTATGGACGTCGAGACT
GGGCCCATCCCGTCGCGGACGCAGAGAAGCAGTGGCAGAGTGGAGAgagaggagaagaaggaggacgcgGGGTCTCCGCCGCCATCCCCTTTGCGGAGTG
ACGTTTCGTTTGATTTCGGTGGCTCGCCTCATGGCTCCGTGGATATGGACGCTGACACGAACGTCACAGTCCGTAAGCGACACAGCAAGAAGTCTACTGG
GAAGGATGCTGAGAAGGCAAAGGCGAAGGCTCGTCGGCGAGAATCGTTTGGTGGGCGTGGCTTTGACGAGGACACGGCCAGCCCGTTCTCCTTGAACGAG
GGTCCAGTGACTCCGCTGTCGAATGGTTCGTTTTGTTTCCTGGATAGTGGAGTGGGAACTGATAACGCTTCTCCACTCAGTGCCTTTTTGAACTTTAGTT
GGACTGACATGTTGTGTTTATTTGGTATTTGTGTTGGGACTGTAGCGAGCGACCGCACGCTGAAGTCTATTCCATCGTTTTCGGACAAGAACTCACTGTC
GCCAAATATTAGCAAGGAATTATTCAAGAAAGGTGGATACGGTAGCGATGCCAGCGATGAAAAACCTAAGAAGCAGGCTAAGGGGAAGAAACCCAAAAAG
GCAGCTACCGGCAAGCGATCGACTAGTGGGGCTAAGAAGACGCCTCGAATCCGGCCGACCGGGAAGTATGGCTACAGGACGACTCCGCCCGCAACAGATA
CGTCGATCCAGTCCGTTCAGACGGATGATGACAACGATGAATCCTTCGAGGCGCAGAACGATTCCGGCGGTGAGACCGGAGATGACAGCTTCTACAACGA
GCCAGAAGCGCCCACCGGTCCGGTTCGAGACAGGTTGCCTGACGCCTCTAAGAttctggacgacgacgaaaatgaCGATGCTTGGGATGGCAGCGGCTTG
CGTCGATCGAAGCGAAGGCGCTTCAAACCGCTTGCCTGGTTCAAGAGTGAGCATATGGTGTATGAGCGCACGTTTGTTGGTGTGGGTACGGTGATGCCTA
CGGTTGTCGGCGTGGAGCGTCTCGGTCTTGACTCTCCAACGTCCAAACGAACAAAGGCCAAACCACCATCGAAACggaccaacaacagcaggGCGTTGAC
TCTAAAAAACCTGCCTAAGGACGTGAAAAAGAGGATCGTGGATAGCGAGTGGGCGACGCTCTACGACGGCCAGGCTGGCTGCATGAACGATCTGAACATC
ATCTGCCGCTCGAGTGAGATCCGTCTTCGCAAACTTCCAACGGAGGAGAGGGGTGGCGCTGTGGTGCACGCGTACGCCGGACAGAGTTTCAACCTGTTTA
GTCCGTCTCCATTTGCTCGGTGGATTTCCGGACGTGTCGTATTGCCTCCCGGTGCGTGGAAGGAACCTGAGGGCGTTGGTCAAGCTGTGCAGTTGTTCTA
TGTTACAGGATGCCAGCCGAAGTCACTGGAGCTGGCACTGGCGCCCGAgaccgacgacgactttTTCACCAGCAAGCACACGACGCACTTTCTGCTCAGC
CCAGGCGACGAGTTCTACGTGCCGGCCGGCAACGTGTACTATGTGAAGAACCACTCGAGCTCGGCGGACTGCGACCTGCGGTTCACAATTTTGAAGCCCG
AAGCCCCGCAGATGCCCTCGGACGACAACGACTCGGACGcagagaaggagaaagagcCGACGACCGAGTCTGAGTCGAAGCCGAAAGCTACCGAGGTAGC
AAGCAGCCCTCTCAAGCGCAAGCGAGAGGAGGGTGCggatgcagatgcagccgcAGACGCCGACTCGGACTCAGTCTAGATACCGAGGCACTGTACATTC
TAACAGCAGTCTCCTCTGTATTCAGTAAATTCGTTTCGTGTGCAAGCCCCAGGTCTCTGATATTGCGGTGGGTCAACGTCTGTCGTGACCTCGCTGTCAC
GCAGTAGGACGAAGAGCCGGAAAAGTGTCTGTCGTCGGCTAACTACTGGACATGTATAGCACCGGCTATTGTTTACTAGTACCCGCTGACAAGTTCATTG
ACGAGTGCAGCATGACATGAATGATACAGCACTTGGTGGTCTCCACTATCCATGTACACGTAGCATCTTCGCCACTTCCAGGTCCCGTAGTAACGAGAAG
AAACGAAACTTAGCCAGATATGGTCGATCGAGTTCGTCGTTCGAAGAGCTCTATGCACAAACGTAATAAGCATTTGAAGTTTGCGCGAAAACGACCTCGC
TCACTGCGTCGTCAACTCGAGCGGCGATCTATGCGCGCATGCGCATGGGCGGCAGCTCTGCTATAAAAGCAGATGGAGCTTGGTCCCTGGATGGATAGGT
GGGCTCgcccagctgctggacctAAGAATACGCGTGGGTCGTCGTTCGGTTTGGTGTCTTTCATTCTGCTCTAGAGTGGAAGAGGTTGGTCAGTGGTAAA
CGTACTGAACGTCGGACAACCCAGaaggccagcagcagactggTGCCTGCCCTATATTGTCAGCtattgttgctgcggtgCTGCCGACACTCGATTGCAT
ATTTATCTTGGCAGCTctcatcaagcagcttgaTACTCGTCATGGATCCtacagcttcgtcgtccaagtgCGTCCTCCCTCCCTGCTTGGTTATCGCGAT
GGCATTTTACTGATAAATTGCGTTTGCGACAGGATGGACGACATCTACGAGACTATCAAAGAAGGCAGCGTTGCGGTGCGCGGCCACTTCATGGTACGAA
CTCAGTCCACGTAGTACGGTTGACACAGACGTCTCACTAGTCGTTGGCTTCTCGGTGCAGTGGCGCGATCGCTATGTTACTATCAAGCCAGGAGAGATGG
TTAtccgtcgtcgacgagagGGAGCAATCAAGGCCAAGGTTGGTTGTTCCCGAGTCTTCGTTGATTCCTGCCGCCTATGCGTCGTATTCATTGTCTGCCT
GCCGCTATGTTTTTCTACCAGATCGATTTGCTCGATACCAACATTAAGCTCACGTTTCTCGGCGGACAGTCACTGCTCACGATTTCCATGCACGGTCGGG
ATACTGTGTTTGACTTTCGTTCGACCGTCACGCGGGACGAGTGGATCAGTGCCATTGTGAGTGCCCAGGAACGTCCAGGCTCTGAAGTGGATTGCGACGA
GGATGGCACAGAGCTCCTGTCCGACGACGAAACAGACGACCACGAAGGACACAAACGCAGCTCGATGACAAGCATGGGGACTGACAAAAGCGATAcgatg
gacgacgacagcgaaggATACAACGACGCATTGCTGGCGTTGCAAAGTGTGCGCGACTCCGTCATACAGTGTCATCTATCGATGGGGGCAGCCGAGATCG
ATACCTTCATTAACCCTCGCGACAATCCTGCCACTCCAGCATTCACGAAGACCGCTCCGTCACTTCGACGAGTGCAGAGTGCGAAGCGTAGTGAGGAGGA
GCTACGACAGAAGCGACTCCGATCCCTTTTGGCGATGATTGAGAGCACACCGCACGGTGGGCGTGTTGTACTATTGCACCTTGGAGTAGTGGCGTCTGCG
GGCATCACTGTCGGCGATATGCTACTGGCACTCGGGGAAAAACAAAGGGATAACCCACGTCGTGGTTCATTCACTCCACGCACTCTGAGCATGCAGAAAC
ACAACGTAGCGGCGTTTGTTCGTGATATTCTGTTCCACCCCATTTACTCGAAACGTGCGGAGGTGAACACCGAGGTTGTCCAGGGTCTCATCGACTTATT
TTTCCCGCATTGCCGTCTGAGACGGTTTAGCGACGACACGGAATGGCAGCAAGTTCAACCGATACAGGCAGCTTCTGTGAACAACGCCTCCCAAGTCACA
GCGAAAAGTGAAAACGATGCTGATGTTGGCACAGCGACAACTCCCACACCAGCAGTTCGACCTCCGCAGAGGAGAAAACGACGGAACCACTCGTTCCCGA
ACTTAAGTGGCATTACTCAACTTGCCAAAAGCAAGGGATTGCTACAAACCTCAGTCGATGACAATGACAGATTCATCAAGTCAAGTAGACTGGAGGAGGG
CGGCCAACGACTGCGCGATAATTTATCGGTGCTCTTTGCTCCGATGTCGCCGTTCCCGGATACTAGCAAAGGCCCCGGGGGCGGAAGAGAGGGCGGCATT
CCTTTTGTGAACACGAGCACACTATTCAACTCCAACTCATCCGAGGAACTCGACGTCGTTTGTGAAGATATCCCTCTTCCTGTGCCACTGCGAAGTCTGC
TATGGGAGATGTCATGTTCGGAAATGGCCGAACAGCTCACGCTTTTCCATCACTCACAGCTCACGAACGTGTATCCGTGGGAGTTTTTGCATCACCCCAA
AGAAGCAGCCAAGGACCTGACAAATCACTTCAATCGGTTGGTGGCGTACTTCGTTTGGTCGGTACTGGTAGAGGACTCCCCCAAGGAGCGTGCCGAGGTC
ATCGAAGACATCATCTCCATTGCCATGGCCGCAAGTGCACCACCGCTCAATAATTTCCACCTGGTCATGGCTTGCGTCGGGTGTCTTGGTGACACGCCAT
TGATGTCTACGCGAATGCCAACCACGTGGAAGAAGGTCCGTGCCAAGTACAAGACACGGCTCGGTGAGCTGCGACGACTATGTGATCACACCGGCGGCTT
TGAAAACCTGCGGCGCAAGCAGAGTATTGAAAGTGCTCGGCCCATGCTGTCCAGCGACGTATCGACTACTTCGATCATTCCTTTCATCGGAGTGATCGGC
GTCATGCTGGAGCGATTGCGTTCGACGAGCTACTTCACAGCAAAGAAAATGCTGGACTTGGAAAAACTCGAGCGCCAATACATGGTGCTTaatgtgctgg
agaacgcACTCCTCAAACCTGCCCCACGACCTTGTCGGGTACCGCAACGTGGAAAGACAGCCCCAAATGAGACTGCGGCTGACATGACAGCTCGCTTGCA
GCAGTTCTTCCGGACTCTCAGTATGGACTTTGCCACGCCTCGATTGCATCAGCTACGCTCACAGCAAATTCTCGTGAATGAAACGAGCACTACGAGCTCG
GCATCTGCTTCACTCGTCCTAGCGGCAACTGTGAACGGGAGTAACAGAGGAGGAATCCCGAACCTCGCAGCTAGCAGATTTGACTCGCATGGCTCAATTG
GTCCCAGCGAAGACTCCGGGTTGCCATTTGTGTCATTCCGAGATATCTGCGTCCTGTTGGTATCAGTGCCGGACGTGCGCGAACGGATGCAAATGGCGCT
CGAGGCGCTCTTCGTGGATGGACGTCAGCCTGCTACGCAGTTCCTGCGCAAGTTCTGGCTCGACTTCAAGCAGAACGTGTGGGTATCGGGCGTAGGGCCC
ACACTACAGAGTGTGCGACTCTGCGTGTCTGCTTTGTATCAAGAAGTGATGACGCACAAGATCACCGAGCTCATGCAGATCAGCGGACTCGATGAGAACT
CGAATGACCTGGACGACATGGTGTACGCGAAGATCGTGGTGGTGACCGTGCAGCCAATCTATCTGAAAATCGTGTCGAAAGTCAAGCGCAACTTCGTCAA
GGAGGATGTCCATGCATCAGcacggctgctgcagagtaCGCCTCAGGTTGTGGTTGATTCCAGCAAGCCGACGATgccgtggagcagctgcagttgcagc
tccCCTATCGAACTGCTGGACCTCGTCTGTCAGTTAGTCGCGTTGCCTCgtgccagcaccaccactgcagccACAGCCGCGACCGACCACCAACTCGCAG
CAGTCGAGTTGCTGGGagcgatgcagcaccaagccCGCCACACATTCCTCGCCACCAACCCGGTGAGCAGCCTGTACCTGATGAAACAGATCCTGGACCC
GAAGTATCTGCCTCTCGCTCGACGGCAAGCGCTCGAGGTGTTCGTCGCCGCGGTGACATGGCTGCGAAAGGAGCAGCGACTCACCTCGGACGAGCCCCAA
GACGCCCTGGTATAGCACGTGGCACGAAATTTCTAGCGATTGCGCTTGGGGGCAGACAAGGCCAGAGCGGACGACAGCCCTGCGTCGACCAACGCAGAGC
TGTCTTGGTCACCGAGAGATATCCATGGCGACTCGCCACtggcgagcagcttcgcGACAGCCACAGAAACAGCCACACAGCCCGGCGGCACGCacgttgt
tgctggaacGCGCATTTTTCCTATAAGAGCATCGTCCTCCACTAATTTCGGAGTGATGTTCAGAATATATTATCTCGCGCCACCGCACTTGTAACAGCCA
AAACTCTATGATGGCCATGTATTCAATGCATGTAAATTAGCAACCCAATGCCTGTCTTGGGGCCATCAAATTGGCAAGTTAAGGTGAAACGACAAGTATC
TTCTGCACCTTTACATTCACACCGTACAATTGCAGAGACGAGGCGGACGTCCTTTCGTCCGCCAATAGAAACGCCGATCTTGACGCGGGAACTGACTGCC
CAAAATGGCTTCGTCACGTTGTCAATGCGACTTTCTCGGCGCGGAACGAGCGCGCACTCGTCCGCCGGCGGCCACCCCCCGCTGCATAGCACACGCCGCC
AGACTCCCTCACCGAAGTAGGTCAAAGGCTACAGTAGCGCCAGCGTATAATACTTAgccctcccccccccctccccctccTTTGGGCGTTCTGATACAGA
CCGTGCAGCCATTTCAGCTCAAGTATCCTCGTGCTCCTCCTCTCTTCACTGATCGGACACTCGCACCCATCTGCGACACCAAGCCACCCACCCGTAGGTA
TTATTTGGCTCTCCATCCACCTTCCATTTCCTCTCTGATCCCTCCCTCCGTCCTTTCGTAGCAGGTCCTGGGTATGCGCGCGTGGACTCTGGCGCTCGGC
GTCTCGGCACTGCTGCACGCAGCTTcggccgccagctcctcgggCTCCATCGCCACGAGTGGCACGCTCAACACCTTgaccacgagctgcaacggcggct
gcagcagcagcggagcctGCGTCGTCGTGGGCCAGTCCTCGGCCAATTCTATCAACTGCGTCAACGACACCAACTGCGTCACGTTGTCGTCGGGACAGTC
GGCACTGTGCCTCGACGCCTTCACCTCGACCGCCACTGAGTGGGTCTTCCAGCCGGCCGAGAGCAACGACACAGCAGGCGCCGGGCCCTTTGAACGCGTG
GGGCTATTGCAACTGGCTGATCATGTGACAGACCTGACATTCAGTAAGGCAGAGCAGGGAGAGGACCCGCTCTCCGGGTCGCTGGAACTCGCGTCCATGA
ACATCCAACTGGATGCGACTCTGGACAAAGTGACGTTCAGGAATCTGAGTCTGTCTGGACTGGACAGCGCCCTGCCGCTAAATAGCGTCAGGAGAATGTG
CGTCGCTctgatgctgcagagcgagagagagagaggcAGAAAGGAGACTGACATGGCTTTTGTTTGTGAACAGATATTTCAACAATTGCTCACTAAGTGA
GATACCTaccactgctgttgctggggACTCCGTCACCGTCATGTAAGATGCcctactgctactgctacaaCTTTTCTACGAATGGTTTTAACTGATCGTA
ACTGGTGTTTGAGTGTTGCAGAGATCTAGCCAGTAATGCCATCTCCACCGTCGGCACCGACTTCCAAGCTGAGTCCTTCTCGAACCTTACCTTGCTGTAC
GTGGAGTCACGTACTTGCTCACCCATTCCCTGGTCAAGTGTTGCTGATTAAAGTAACGTTATTACTATTCGCGCAGTGATTTGTCGTCAAATTCTCTGAC
TGACTTTAACCTTGAGGAGGACAACTTCCCAGCCATCACGACCCTGTGAGTACAACTACTTGTCCTGTGTTTAGCTTTCGCCTTCGACAAGATCCTGACT
GCTTGTTGTTCGTTTGTTCTTGTCGGCAAACCTAGATATCTTCATGACAACTCGCTGACAACGGTTCCCGACGTGATCTTTAATTTGTCGACCCTGCAGT
TCCTGACGCTGGTTAACAACCCCATTAATGCGTCAGATCTGACAGCGCAGCAGTTTACGTTCCTCGCTAACTTGCGTATGTTTACGATTGATGGCACTAC
CAACACGAGCGCATGCCCGACTACTGCAGTTCAGAGCGCGCTAAATGAATACGTCACGTTTTGCGTGGGAAGTGACGACGTCGAACCCTCAAACACCACG
GTTACCGAACAGCCTGCGACAACAGTACCTGCAACTACTGAAGGTGattcctcgtcctcttcatcaaacAAGACATGGATCATTCTAGGCGCGTGTCTGG
GGGCTGTTGTGCTGCTATTACTCATCGGCCTCAtttggtggtgctgttgtcggcGGAGAAATGAACAGCCCAAGCTCACGAACAGTACCATGCCATCAAT
TGCGATTGGCATGGGCGACCTGTCGGACCACCCGTACATGGAGCTAGGTGTTCCCCGTTCCAACGCCTCCAGTCAGACGACGTCGGACTTCGAATTGCTC
GCGTCTGTGGCAGACGGCTACATCGGACTGACTCGGTTGTCCTATGACGATGTCTTCCTGCACAAAATGCTGCGTGTTAGCAGCCGTTCTGAGCTGTGGC
TGGGCGAGTACAAGCATGAGGCTGTGCTCGTGAAGAAAATCAAGAGTAACACTGCTTCAAAGGCGCTACTGCGGGACTTCGTGACGGAGATCGAGCTTAT
GTTCGAGCTCAAACACCCTCGTATCGCTGCCTTCCGAGGGGCCATGTGGGACGCTGATGGCACGGAGCTCTGCGCTGTGGTCGAATACGTTGAAAAGGGT
GCTCTGCGAGACTGCACAGTAGACAACGCCGTCGAGCTGTCCGTGCCGAAACAGCATGCTATTGCTCGGCAGATCTCAGAGGCTATGGCGTTTCTACACA
AACAGAACATCGTGCACGGTCGGTTGAATGCGTTCAACATCCTGCTGGACAAGGGATACTCCGCCAAGCTGAGTCTCTTCAGTATCTTCCACTACGTCAA
ACTGTCACCTCTGGACAACGAATGCAAAATCTTCGTGGCTCCTGAGGTTCTGCGCGGTGAGCAGCCAACGGAAAGGTCAGACGTATACGCATTCGGCGTG
GTACTGGTGGAAATCGATACTGGCGAGACCCCTGTGATGAACGCTCGGAGGCTATCGATGGAGCGGTCAGGTCGCGAAGATGTTCTCTCCTCAACTGCGA
AGAAGACTGGATTTCGCCTGAGTCGTCTCTGCTCCGGGGTGATGAAGGAAACCATCGCTGCATGTCTGGAGAAAGATCCCGCACGACGACCGTCGATGAC
TGACGTGGTGTTGGCTTTCAAGAATGGCGCGATGAAGCTGTAAGCTCTCACTCGCCAATCAAACAAGCGTGACACGTACGTACGAAATCATCCTGAGAGG
CATCTATTTTATTTTCCATGCCAACCGagccagacgctgctgcataACGCAGAGTTCGGGAAGGTGTAAGCTCGCACTAAGGAAACCTCCCAGCCGCTAG
TCCGCAAGCCCAACAATTCTCTTATGTAAATAAAACGAAAACAATATTTGGAGACTCGCTCACTCGACTATGCCTCAACCAACGCGTGGTGACTTCAATC
TTGTGGATGACATCTGCAAAATGTGACGCGACTCGATTTCACGTGGACGAACAGATGGAGTGTA