Description :
From Genome Similarity Track
Location :
Scaffold_92:73172- 79609
Transcript NameFunction/comments
Physo_140961hypothetical protein
Physo_140962hypothetical protein

Sequence
6437 bases(100 bases per row)
GTCTGGCGGAGCTGCTGGAGATGCGCGAGATAGAGGCGCTGCTGAAGAACGACAAGAAGCAGCAGAAGGACCAGCAGCAGCAGAAGGACGAGCAAGCTAG
CGCTATGCGCGACGCAGCCTTAGAAGGGATGAGCCGAGGAGGAGGAAAAGGTGGATCGCAGCAGCAGCAACTGGTTGCTAATCTCGAACGCCGCGACCAA
GTCGCTCAAGCACTGGAAGGGAGGAAGGTCGCCAACGAGGAGAAGCGGCTTGCGTTGGAGGAGCGACGCCTGGAACTGCAAGAGCTGCGAATGGAACTTG
AGCGAGACGAGCGGCTTGCGTTTATTGAAATGTTAAAGGCTGTCGTCAGCAAGACTAGTTCGTAGTAGCTAGACTAAGATACTCCTCGAGGCTTGTCGGC
TTAATGGAAAAGAATTTGCTGATCTGGTTGGGGTTGGAACAGTTGCGGAAGTTTGTCAGGAGTACACCGACCAAGTAGTGTTTCCCCACAGGTGATAGAT
ATAGTCTTTGACTCAGTCGCTGATCAAGAAACGGCCATAAGCGAATGATCCCTCCACTGCCACGCGAACTTTACTCATAGCCGCATTGAATGCCTTTTGC
GTATCACTCAGATTGGAGCCTTTGAAACCGACGTGCAGCGTTGGTTTGAGTGGGTAGGCAGGATCCCCATAGATGCAATACGGAAGTTCCCCGTCGTGAT
GTAAGACACGCGGAAGGCGCTCCAGCAGTCCACTCTGCCTTAAAAGCCAAGAGTCGCGACGACGTCCAACCGTAGGACCGTAAAGTCGATGAATAGTCCG
TCCGGCGCCATTACTCCTTGGTATTTTAGCGCGTGTTTCCTCTTGTGTCCGTTGTAAAATTGTTTTTGGTTGCGCGTTGGGCGTGCGATAGCACGCACAG
TGCCATCGATAAAACCAATGCATCTCGGCTCCAGTGCTCCACGTTGTGCCACAGCAGCAGCGTACTCCTCCAATCGCGACGATGTAAGTAGCCCACATTC
AATGGTGAGTAGGCATTTGTACTTGTCGTACACCAACCCCAGCATGAAGTTAAATATCATGCAGACAATAGGGGCGGACCGCCCGAAAAAGCGGCTTAAG
TCTCCATAACGTCCCGGGTATGCCAGGCGAAATAGGTCTCGCTTCCAGAAGCGACAGTAGAACCGTGTTTCGTAGTCGTTGAGCGCGTTGATGTTAAAGC
GTTCGCCGTAGGAAATGGACCGGGGGACGTTGCTTGTGGACGACGTTCAAGCAGAGAGGAGACAAACCGTTTCTTCCTCTGAGAGCATGCCGAGCACGAG
AAGGTCTTGTACGTAAGTAGAGTTCATCTTTGAAAATGCTACAGACGTACAAGTCTAAGTTGCGAAAGCTCGTTCTAGAACTTGGCCGAATAAATCTATG
GCCGCTCTCTGTCAAATCTTTCGAACGGCTCTAACTTCCACAAGTTTAACTTGCGAAACCTCTCTATTGTATTGTGTCTTTCGGTCATTTTGCCGAGTCC
TGCGTAGGACTTTGGAGGTCAGTTAATCTGAGGTTGGCGGTCTCTAAATCTGAGCTGCAAATCTCGGACGAGTCCGATGAGCGGTCTCCCGGAGTCTTCC
GTTCAATGGACTCCGGTTGGAGTCCAAGCCAAGCAAGCTTTGTTTAGGGAAGCATGCAATGCCGGAACCCGCGAAGGCGAAGGGCGAAGACTGGAGTGTT
TAACGTATCGACTGCATCGTGTTTCCCTAAGTTTATTCTGCGTTTGACATACGCCGTATTAGAGTCAGCTCGTATGAAAGTCCTGCCACAAGACTTGGCA
GGAGTCCTTCGTAAGACCTCAAACCCCGAATGCCGTGAAAATGGGCGACATTCGGACTTTCGGCTGTTTGTAGGACCTGCGCAAGTGCTTCCATCGGACT
AGCAATTCTTGGTCCTAATTCCCTACGACGGACCTGCTAATCTGCTCCGATAACCTAGCCCCATCTTAGTAGGTAGCTGTTTTACACGTCCGATTCGCCA
AAACAACTGAAAAGCACAATAACTTGCAATTTGCAAGAACCACTACGATTCAAATCCCTGATCATGTTCCAGTTGGTAATAACGAAGTACCTCACGTGAT
GAATGACCCTGCTTTTCGGCCACGACTGCGGCACTAGAGGGGAGTGGTTAGAGCAACCATAAGTATGGTTGCTTTTAGCCATTCTGAGACATGTATGGTT
GCTTTTAGGGATTTCAAAAATTACGAGCGTAATTTAAATGTCTAAATTACAATAAGCCCTTAGGTACGCAAAGTACGCTAAAGTGCGCTTCTGATTAGGT
ACGATGCCATTAAGTGCGCCACCTCACAGCCGCTCATTTTAAGAATCGCGCTGCTGAACGGAGGCCACGTGGGGCACGCACCTCTCGCGAATCAGTCAAG
CACCAAACGGCGAGGGGGGACCGATGGCTCCTGCGGGGGGAGCCATTATAAACGGTAATCAGTATGCTCCATGTTGGTGGCAACGAGAGTATCTACGTGC
CTCACATTTTGTTTGAATTCTGTCGGTATGTATTGTTTAGGCCGAAAGCTGCGGAACGTAAACGAGGAGCTAAACTACATGTACGCCGCTCTCGGGATTA
AAAAAGACGACGACGAAGACGAAGACTTTGTTCTGGACGAGGAGGATGAGGAAGACAACGGCGACGAAGAGGCGGAGGATTGCTACCAAGAGGAGGAAGA
CGAAGAAGAGGTCGATGATGACGAGGAGAGCGATAGCGATGAAGAGGAGGGTGACGACGATGAAGAGGAGGCGAGTGACGATGAACAGGAGGCAGACGAC
GACGGAGAATCCAGCACAGAAGACGAAGCAGAAGCGGGTAAGACTCGTTTGGATTATTGTTGATACTTACTGAGTTGAACTGATAATGTATTGTGTATTT
TTTTAGTTTGTTTAGAACGCAGGACACGCAAACAGAGTCCCGAGCCGAGAAAGAAAACCACAGCACGCAAGAAAACACCAGGTATTCTCGTTAAAGTTGC
TTTAAGCAAAAAGGTTGCGCTATCATTAATATTGACATTCACTTTGGAATCGATAGATACCGCTCTGGCCAAATGCAAGCTTTCTGCTGGGGATGAAGCC
CAATCTTTCGCGAAAAAGCGTAAGGCGGAGCTGCAGCTTCACGAGTCTGTCGACGCTGATTCGGCCCCACGTTTATCCAAGCGGAACAAGCAGTACATAC
CGCGGAAGCGATCAAGCAAGCACCTTGACGAGTTGCGGGAGATCAACGAGGAGCGCAAAGAAATTATCAACCCCGTTCCGCCCTTTACCCCAGCGATTAT
CAAGAGTTGGAGCAAGTTCAACGCACACTTGAAAATATACAAGCAGAAGCACCACCTCAAGTTTCGAGTACGAAGCTCGGAGACACGAAATCAGTACAAC
AGGTATGTGTGACCTCTGTTTGATGCGAAATTTAAGTTATTAACGAAACCCCCTTTCATATGCAGCAATCATCGGGACCAAATCCCTTCACGTTTTAATT
GGAGTCACAAGGTCCTCCGCTGTACACACGGTGTTTCGCAAGCGTCGCGCTCCAAGGGACATCGCAATAGAAAAGGCAACTATTGCAGGTGTCCTGCACG
CATGACACCAACCGTTCAGCGGATGGAAAATGGCAAATTTCGAATTGTCATAAGATACGAGGTATCTGCCTTTTCGTGTATTTGTTTGCTTTGTTAGTAT
TTCTTACATGTCGCTGTTGATAATCAGAACTTTACCCACACGCACCCGACCACCCGAACGCAAGCATCGTTGTACCTGACAACAAAGACACTTCCGTTGG
ACGAGCAAGATCTCGAAGATGTTAAGACTTTAACGGATGCTAGTGTTTCTTCCAAGCACATCACGAACTTCCTGAATGAGGGAATCGGTGCGTAGTTTTA
TATATGATTTGCTGAAGTGATACTTACGTTACTGTTCGCGCTTTGTGTGTTTGCTAGGCTGCAAAATAACACCTCAACAGACCCGTAATCTGATCCGCAG
TATTATGGGGCACGACGCAGCGGAGGCCCGTTTGAAAGACATGCTGCAAGCTATCCGCCAGTTAGACGGTAGTGACGTCCTTGTTATTCAAGACCAAATG
GACGTGACATGCGGTATCGTGATGCAAACAAAGGTGCAGAAGTTGATGTTTGAGCGCTGGGGCGACACTATTACGATGGATTTCACTCACGGCACGAACA
ATTTGGGCTATCACTTGGGTGCGTATGAGTTGTTCGGTATAGCAACTTTATCCTTGTTACGGCAACCTTGCGTAGTTATAGCAACCATATCGATGATATA
GCAACCGTATTAACAAAGTGATTTCCTACTGTTGTGTGTTGGATATTTCAGGGAGTCTGGTCGTCACAACCGCTACTGGTAGAGGGTTCCCAGTTGTAGA
CTTCATATGCCTCAACCAACGAGCTCCGATGATGACAACAATCCTGGAGTATTTCCAAGAGAAGAACCCAAGTTGGCGGATGATATCCTCCATCGTGATC
GACAAAGATTTCGATGAGTGGAGGGTGCTGAAAACACTATTTCCTGCTGCGAAAGTTTTTAGAAGAAAAAAGGAACTTTGTCAATTCCATGCCATTTCGT
ACTGGAAGAAGGTGATGCAGCGGGCCCCATACAAGCTGAAGGTGTCTGAACGCGACGAGTTACTCAACCTGATGATAAAAACGCTGTACAGGTACGCAAC
AGGTTCTATTTATGATTCTTGTGGTAACGCTAACTTTGGAAACAAACCATATGCAGCTCCACAGAGACAGGTTACGATTCTAGTTACGGTGCATTGAAGC
AATACTGCGAAGACAACAAGAAACAAGCTTTATTCTCGTACTTTGAAAAGAACTGGGATTCGTGTCGAGACATGTGGGCGAACTTTGCTCGCAGCAAATT
TTCCACGGCTGGGAATACTACAACGAACAGGATCGAGTCAAACTGGAATCAAGTGAAAATACTGTTGGGGCACAAGACACGAATTGACAAGACTATTGCG
GGCTTGGTGCAGCATCAAATCATGATAACTCAGCAGATCGGGTTCGTCATCGCGCAGCACCATTCGACTTCGCCCGTTCCTAAAACCATACCGATGTTTC
TCCTGACGGTAGCAACTCGACTGTACCCTGACATCTTCGAGAAAGTGAGAAAAGAGTGGGAACGATTTGTGAACTTCATGGCAGATGCGACTTGTGAGCG
TACAGCGTCGAGTCCTTCACAATGGAAAATTATTGCGGGAATCAAACCTTTCGCTGTCACGATGTGGAGTGGACGTGTACTTGTCTATTTTATAGCAGTC
ACCATTTACCATGTCGTCATCTTATGTACTTAGCACGCGAGGGGCATGGCTTCAAACTGCTTCCAGCTATGGCAATTCATGATCGGTGGAGTTCGTACCA
GACCTTGGAAGTGAAAAACGAATTGACGGCTGCAGCGGAAATGTTACAGCCAATTGTGCAGATGTCCAAGTTAAGGTTGCCGAAAGTAAAGTTGCCGAAC
GACACTGGGGCTGAACCAGAACAACCACTTTATGCTGCGGGGGGTAACGCTTCGCCAACCAAAGCTAGGAAGCAAGTCGCGTACGTACGGCTACGGCGAG
GTGAACGGGCAAACCAGGTTGTATTGTCTTCAGCTGAAAAATACGCATACGCAAAAGCGATGCTGGAACCGCTATTGGAACACCTGTCAGATTTGTCTAG
TGCAGACTTCTACCAAGAGCTAAGTGCCTGGAAGGAAACGATCGACATAGGGCTCAACCGTGTCAACCCTGCCCCCCAACCGAGTTCTACAGAATCTGCT
GAAGATAGCAAGCAAGAAGAAGATGTATCTGAACCTGTCTCAGACTCCATTCTGGACCCCGTGGAGGCAATGGGGACTATGACGCTCATGGACGCATTGG
AAAGCAGCCCCATGACCATGAATTATGGCGATTACGAGTCCGACGAAAGTATGTTACCGACACAACGCATTTACCTTTCGCAGTCATCTCCAATTCGACC
CCCCATCGACGAGAAATCTCATGACAGCTGCGGAATGAGTAGCTGTGACAAGGTTTCAAGCTCTACGAAGCCTGACAAAGAGTCGCGCGTGCGCCAGGTC
AATGTCGTTAGAGTTCCTAAGCCACCAAGCCAAGGAAAGTCAAGGTCAACTCCGAAACAGCTGAGGCAAACTACGATCAGTCTCAAAGCCGACCGTCTTG
CTGTTCACAAGTACCCCACTGAACTTGCCGTGACTTTGGATCAGTTCCTGATTTGGGCCAGAAAGACCTCAAATCTGAAGCGCGTGATGGAGATGCTGTC
GAAGTATCCTGTTCAGCTGGAGGATGCCTATCTACGAGCTCGGAAGATTGATTGTCATTGGGAAATTGTACGACCTGCGGACTACATGCACACATTTGTA
ATTCCACAAGACCTCGTCCTATCAATGCAGGCAGCAA