Description :
From Genome Similarity Track
Location :
contig_23:731690- 734121
Transcript NameFunction/comments
g6169.t1hypothetical protein

Sequence
2431 bases(100 bases per row)
CACGCACACACACATGCAATTATTGGATTAGCAAAGTTCGTGGCCGAACCTCATCCTCTCCCCCGCTCGCATAAGCCTAGCAGCCGTGCCTCTCACCCCA
GCTGCTGCCACACATCATCTGCATTCGAGAGGAATTGAACCTCTATCTCCGCGAGCGGAGCTTTCCCACTAAGCTACGAAGGAGCGCAAGAGCGGTGACA
TCAGCTGGGTGCGATCAGCTGTCGTCGAGTGAAGGTGTCGGTCCTGGCAGTCTTGGCGTTGTCTGCGTGACCTGAGCGTCGCTCTCGTCCTCAGCTTCCT
TTCGCTCCAGCTTATTCTTGAATGAGTGAGAGTAGAGGCTCTCGTCCATGAAATGAAGTGTCACCTTCTGATTGGATGATGATATTAGGGATCGGGTACG
TTTTATGGGTGTCTCCGCTCCACTTTATGAAAGTCCGATTTACTTCGCAAGTACCGATGTCGCCCGTGCGTTGGCTCGGCAAAAAAGTCAGAAAAGCACA
ATACCTAAAGTTGCAGAATACTAGATTTTTAAAAGGCGCGAATCGTTGCTATGGAACTAGCCGGTTACACGACGGTTTAGAGTAGTGGAGGAGCGCTGAG
CACTTCCTCCATATCGTTTTGATCGTTACAATCGTCTTCGACAAGCTCTTACGGAAGAGGTACTGCACGCCATGCGCATCTGATTGGGTAACATAAATGT
ACAGTGCTTCCGCTATCCGTTGAAAGTCGAATTGTTGGAGAGTGATGTCTAAGTTACTGGCTGTGGGAGCTCGTCAGTTCAGCCGTTGTTTTCCAGCTCG
ACACGCTGCACCTGCCACAATCATCCCCTCACTTCGTAAACTACCCTGTATTGACCCTATAACCAATTTAGACGATTCAAACCGCCGCGCCATCGTCAAC
GTCGTTCTGCTTCAAGCGGTAGGTGGTAATGTACATCGCGTCCGATATGGTGTTGTTTTCGAGCTATTACTCGTGTTTGGGACTGTTTTAAGGTGACGGT
GGCCGACGGAGTCGTAGAAGGCGACGTTTCCAGCAGAATCAAAAGGAAATTCGGGCCGTCGAGGGCATGACAGGGATGAATTAGTTACCAAGATCAAGGC
AGTCCTGTTACAAGAGCGGTCGGGCGATGACCACAACGGCGAAGGCTGTTGGGGTCTGTACGGGCGTTCTATAGCGCTCCTGCGCGAAAAAGTGGTGCAC
CGCATCATGTCGAGGATCAAACCCGCCTTGACACCACAGAACATGGCCGCCCGAGTTGAGTATGCGCTGTTGTTTATCGACGAAAGGAGGTTCGTTTGTC
GAGTCCATGTACGATATAGTACACGTGGACGAGATGTGGTTCTACGAGGATGTGAACAAACAATCGTACTACACCGTAGCAGACGAAAAAGCGCCTCCGT
GCCGCCATAACAGGAAGCGGTTCATACCCAAGACAATGTTTATCACGGCAGTGGTCAAGTCCAGGTAACCTGACAAATGTTTACTTATGTACGTGCCATT
ACCATATTTGTTCCGTATATTATACAGATATGATTACCATACAAAGTCCAGGTTTGACGGCAAGATCGGAATCTGGCCGTTCACGGTGGACTATGTTGCA
CAATGCTCAAGTGTGAACCGTGTCAAGGGAGACCCCGTCACCAATAATATCGATTTCATCAACAGGAACATCTACATGGACTATCTCATTGGAAAAGTCA
GCCCCGCCATCAAGGCTAAGTATAGGGGTGAGAAGTGGGAGGTGATTTTCACCCAACAGGACAACGCAAGACTGCACCTTTCGCCGTTTGGTCCTGGCGT
TGTTGCTGCCGGTACGTCCCTAAGCTGATACATCTGACTGCCCTTCCAGCCGCTGAATTCGCCCGATTTCAACGTGCTTGATCTTGGGTCGAGACTCTAG
ATAATGTGTTCTTGTTGTTGCAGGTAGTCATGATATGTGCCCTTGTGAGTAATGGAGGAAACGAGTACAAGCTTCCCCACTACAATATAGCGCGGCTCAG
GAGAGGACACAAGCTACCTGAGTCGCTGTTGGGATGAAGCGACTTACCAGTTGCTGGAATTGAGCGATCAAGATGGAGACTGATGGCATGAGATCACGTG
TTGAGGGATCATGACGGAAGAATTTCGGTTATATCCGGTTATGTCCAGTTGCGTTCAGAAGACATTCACCGCCGGCCCGAAGTGGATACATGTCGATCTG
ATGAGTATGGCGGAATCATCTATGTCGGCCTGATCAGATCCATGTGGGCGATCATTTCGATACGCGGACTGATCCAGGTCAACGTGGCATCATCATTTCG
ACACGGGCGATCACATTGATTGTGGGTATAATGGAGCGATCGTTTCAGTACAGGACCGCGAGATTGGTACATGAAATCAAGTTCAAGCTACAGTGTGCAA
TCAGGAAATGCACAAGCGGGATAGGGAGAGA