Description :
From Genome Similarity Track
Location :
contig_23:731660- 734091
Sequence
2431 bases(100 bases per row)
ACACACACGCACACACACATGCAATTATTGGATTAGCAAAGTTCGTGGCCGAACCTCATCCTCTCCCCCGCTCGCATAAGCCTAGCAGCCGTGCCTCTCA
CCCCAGCTGCTGCCACACATCATCTGCATTCGAGAGGAATTGAACCTCTATCTCCGCGAGCGGAGCTTTCCCACTAAGCTACGAAGGAGCGCAAGAGCGG
TGACATCAGCTGGGTGCGATCAACTGTCGTCGAGTGAAGGTGTCGGTCCTGGCAGTCTTGGCGTTGTCTGCGTGACCTGAGCGTCGCTCTCGTCCTCAGC
TTCCTTTCGCTCCAGCTTATTCTTGAATGAGTGAGAGTAGAGGCTCTCGTCCATGAAATGAAGTGCCACCTTCTGATTGGATGGTGATATTAGGGATCGG
GTACGTTTTATGGGTGTCTCCGCTCCACTTTATGAAAGTCCGATTTACTTCGCAAGTACCGATGTCGCCCGTGCGTTGGCTCGGCAAAAAAGTCAGAAAA
GCACAATACCTAAAGTTGCAGAATACTAGATTTTTAAAAGGCGCGAATCGTTGCTATGGAACTAGCCGGTTACACGACGGTTTAGAGTAGTGGAGGAGCG
CTGAGCACTTCCTCCATATCGTTTTGATCGTTACAATCGTCTTCGACAAGCTCTTACGGAAGAGGTACTGCACGCCATGCGCATCTGATTGGGTAACATA
AATGTACAGTGCTTCCGCTATCCGTTGAAAGTCGAATTGTTGGAGAGTGATGTCTAAGTTACTGGCTGTGGGAGCTCATCAGTTCAGCCGTTGTTTTCCA
GCTCGACACGCTGCACCTGCCACAATCATCCCCTCACTTCGTAAACTGCCCTGTATTGACCCTATAACCAATTTAGACGATTCAAACCGCCGCGCCATCG
TCAACGTCGTTCTGCTTCAAGCGGTAGGTGGTAATGTACATCGCGTCCGATATGGTGTTGTTTTCGAGCTATTACTCGTGTTTGGGACTGTTTTAAGGTG
ACGGTGGCCGACGGAGTCGTAGAAGGCGACGTTTCCAGCAGAATCAAAAGGAAATTCGGGCCGTCGAGGGCATGACAGGGATGAATTAGTTACCAAGATC
AAGGCAGTCCTGTTACAAGAGCGGTCGGGCGATGACCACAACGGCGAAGGCTGTTGGGGTCTGTACGGGCGTTCTATAGCGCTCCTGCGCGAAAAAGTGG
TGCACCGCATCACGTCGAGGATCAAACCCGCCTTGACACCACAGAACATGGCCGCCCGAGTTGAGTATGCGCTGTTGTTTATCGACGAAAGGAGGTTCGT
TTGTCGAGTCCATGTACGATATAGTACACGTGGACGAGATGTGGTTCTACGAGGATGTGAACAAACAATCGTACTACATCGTAGCAGACGAAAAAGCGCC
TCCGTGCCGCCATAACAGGAAGCGGTTCATACCCAGGACAATGTTTATCGCGGCAGTGGTCAAGTCCAGGTAACCTGACAAATGTTTACTTATGTACGTG
CCATTACCATATTTGTTCCGTATATTATACAGATATGATTACCATACAAAGTCCAGGTTTGACGGCAAGATCGGAATCTGGCCGTTCACGGTGGACTATG
TTGCACAATGCTCAAGTGTGAACCGTGTCAAGGGAGACCCCGTCACCAATAATATCGATTTCATCAACAGGAACATCTACATGGACTATCTCATTGGAAA
AGTCAGCCCCGCCATCAAGGCTAAGTATAGGGGTGAGAAGTGGGAGGTGATTTTCATCCAACAGGACAACGCAAGACTGCACCTTTCGCCGTTTGGTCCT
GGCGTTGTTGCTGCCGGTACGTCCCTAAGCTGATACATCTGACTGCCCTTCCAGCCGCTGAATTCGCCCGATTTCAACGTGATTGATCTTGGGTCGAGAC
TCTAGATAATGTGTTCTTGTTGTTGCAGGTAGTCATGATATGTGCCCTTGTGAGTAATGGAGGAAACGAGTACAAGCTTCCCCACTACAATATAGCGCGG
CTCAGGAGAGGACACAAGCTACCTGAGTCGCTGCTGGGATGAAGCGACTTACCAGTTGCTGGAATTGAGCGATCAAGATGGAGACTGATGGCATGAGATC
ACGTGTTGAGGGATCATGACGGAAGAATTTCGGTTATATCCGGTTATGTCCAGTTGCGTTCAGAAGACATTCACCGCCGGCCCGAAGTGGATACATGTCG
ATCTGATGAGTATGGCGGAATCATCTATGTCGGCCTGATCAGATCCATGTGGGCGATCATTTCGATACGCGAACTGATCCAGGTCAACGTGGCATCATCA
TTTCGACACGGGCGATCACATTGATTGTGGGTATAATGGAGCGATCGTTTCAGTACAGGACCGCGAGATTGGTACATGAAATCAAGTTCAAGCTACAGTG
TGCAATCAGGAAATGCACAAGCGGGATAGGG