Description :
From Genome Similarity Track
Location :
Scaffold_894:7315- 8424
Sequence
1109 bases(100 bases per row)
TTAATTATCAATACAGACTTCTATTTGCACGATAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGTGAAGGTT
AGGAATTGCGAACCTAGTGTTAGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTATACACGTGCAGATCCAACAGG
TTAGCCGAATTACTACTTGGTCGGTTACACCCTAGAAGATCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAAAACACAAAG
GCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCAC
GGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCACCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGA
GAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCA
GTTGGTAAGTTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTACCCGGATCTTTTGGTGACTCGAGATTTCACCGT
GAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGG
ATCGATGGAGTTTTGGGAGGAACTCTGTCGACGAAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTTTATCCTTCCCAGGTCCCCTCGGG
GACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTACCAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACA
CTGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGCGTCGGAAGAAG
ACCAAGCTG