Description :
From Genome Similarity Track
Location :
scaffold_61:73149- 78546
Transcript NameFunction/comments
g2459.t1 hypothetical protein PHYSODRAFT_350280
g2460.t1 hypothetical protein PHYSODRAFT_482072

Sequence
5397 bases(100 bases per row)
TTCATGTTACTACTTTTTGTGAACCTTATGTTTAGCACATCAACCTGACCCCTAGTGACGCGCAAGCAAGTCTCCGTTCGACGCATTCCCTTTCTTGCCA
TGAGCGTGACGCTGTCGAGTCGCCCCGCCGCCGTGTATCTGGGCGTGGGCGTGGCCATGCTGGCGTCGGTGTCGCTGTCCAGACACAACGCCAAGCTGTG
GCGCGCCCTCCGTCGCGCATCCGCAAACTGCCGAGCTAGTCGCGGACTGTGCAGCTCTTCATCTGGTCAACTGCCGAGCGCTCGACTGCTGCCATGCGCT
ACGGAGCTGGAACAGGCGACTCCCAACAGACTCAGCGCGCAGAAAATCACGGTTGTACAGGTGCGAAGAAAGTATAGATTTTTTTAGCAGGGGGACGCTT
GGAATTGACAATGTGCTTGTGAATTGAGCAGTTGAACATCCTGGCGAGCAATTTAGCTACACGCAACCACTTCCCGTACGTGTTGGAGTCCAGCCTCAAC
TGGGAAAACCGCAAGATGGCGTTGTTGCGGCAACTGGACACGTTGGACGCTGACGTGCTCTGTCTGGAGGAGCTCAGCGACTACTGGACGTATGTGGGAT
GAGTGCTGTGGGTGTGCATTGCAGAAGACGGTGCTTGACGCAGTGTGTTGAATTGTGCAGGTTCTTCAAGCCAGAATTGCAGGATAGAGGCTATGAGAGT
GTATATGTGAAGCGTCCCTCTATCCACGTCTCGAACTGGTCTGGCGAGAAGAAGCATGACGGATGCGGCATTTTCTACAAGTGAGCGAGCTGAAAGAACT
CTTGCTGGCGTGGTGTAGTAAGTTTTACTAAACGGCTGTTGATGTTTGTGAACGTTTTTAGGAAAGATAAGTTCGAGTTGAAAGAGTTCGAGGCCGTGAA
CTTCCATGACCCGCACGACCGCGTGGCTGTCTTGGCGCTGCTCAAGATGCGCCACTTTGCACAGTTCGTGTTAGTAGGCTGCACGCATCTGTGGTGGAAC
GCCAAGTACGTTTGCTTTTCTTGGGTTTTGACGAGGTATCTGCTACGGAATCTAACTGCACTGATCACAGGAAGGTGGATCACCAGATGGCTGAGCTGTA
CGAGCTTGAGGAGGAGGTCATTCGAATGAGCACCGACGTGAGGGACAAGTACGAGCGCGATTTGGCTGGAAGTGCCACTGGTCAGAGCAGCGTCCCCATC
GTACTTTGCGGCGACTTCAACAACTCGCCCGATTCGCCAATCTACGAGTACATGGAGAATTCGTTTATGCAAAAGCCCAACCTGGAGGGCGTAAGCGAAG
CTTTTCGGAGCGCTTACGCGTTCTACAAACCGAATGCACTAGCGAGTGCATTGGAATACTCTGAAGAGGTGCTGCAGTCTCTCAAGGTCGAAGAAGGCAA
GAAGGCAGAGCCACCACATACCACCGTGAACTATCGGCGCTGCTGGACGATTGACTACATATGGTACTCGAAGAGCAGTTTGGTGCCTTCACGAGTACTG
GAAATCCCACCTGAGAGCGTTCTGCGTGCTGAGGATGGGCCAGGGAACTGGTTCAATCGCCTTGCCATGGCTGACAGCTTGAACCGTTCAGGTCGCTTGC
CATCGGGCTTGCACGGTAACTACAATGGAATCCCCAACTCCGTCTTCGGCAGCGATCACGTGCCCATCATGGCCGAATTCGAGTTCCTCTGCGCCAGAGA
GGACACGAGTGTCGAAAGCAAAGAGTAAAGTTATATCCATCCAAGAGAGACCGAGCAAAAACCAGTTGTCTTCATCATCCTCTGCGTGCAACAGTTTGGT
CCCGATTTCGTATTTTTAGTCCAATTTGTGTGTTCAAAAATGCGAAAAACTGTCGTGTCAAAACAAAAAGCGACGTACGTTGTCAATGGGAACTCCCATT
GGCCTTCACCGTCGGCTACATGTAAGGGCGCCCATGCTGCCTCTCAGCCAACGCAACGTGTTTGCAGTCAAGCTCCGGGTAGTTGCAGTGCCTTCCTCAG
CTCTCCAACCGCGTCCTCCATTGGTATGTTGAGTATTGTGCCACAGCAATGGAATGACACATGGAATTGTCGAGACTTCTGACACTTTTAGTGTGTGTCC
AGGTGTGCGAGGCATCTACATGGGCCCTAGCGGCCGACGGACTGCAGCAGAAGTGGAAGGGTCTGAAGCAACGCACTGTATGGCGCTATAAGACGCTGAA
GGACACTGACACAGCCATCGTCTTCAGCGACGAGAAGCAGAAAGAAGTGCACCTGAAGCCCCGCAACCGACGGCTGGACGACCCTCTCGCCTGCCACAAT
GTGCTGGCTGCAGCATCTACGGCCAGTCTCAACGGCGTCTTGGGTGCCACCTCACCCGAGAACTCGAGCCAGTTCTGCAGGACCATGGTAGGCTTCATGC
TGCATTCGTGCTCGCCATCCGAGCGCGCAAAGGTACTGGATGTCCTCACAAAGCAGAGGCTTGAGGAGATCACGATCGCCAATCGGGCGTTGGTTATTCG
AGCCATTCAGCACTGTTTACTATCGCCGTTGATTCGTGACAAGGCGGTGCTGCACAGTGCAGCGAAGAACGTGGTCTGCGGCACGTACGGACTCGAGCTG
TCGGTTCTAAAGGAACAGATTCACTCCGATGAAGAAGCTTTCATAGACTCGGCTGGTCACATTCAGTTTGAAGACGACGTGGCGCCAGGTAAAATATCGT
TTCGACGAAGTGTTCATGCACAAGAAGAACCGCCGCACGCGGGAGACCTCATTCAGCTCATTTTTGGCAACAAGAATATCACGGAAGTCGTGACGATGAT
GCAGCATATCGCAGTGGAGAGTGTTAAGGTGAAAGAACAACAGCCGAACCTGATCAAGGTCGTCAGCGATATCGACGACACACTATTCCCAGGATGGCTC
GACAAGCGTTACCCGCTTCACATCCCGTACCCTGGTGTTTCGGAGCTCTACGCTCGGCTCTCGCACGGACTGATGCAGTACTCGAACGGCGACGACGCGC
GTCCATCGATTACGTTTCTCACTGCGCGACCTCGCGGGTGGCTGAGTGTTGGGCACTATCTGACGCTGCAGCACTTGAAAAGCCTGGGTGTTCCGAACGT
CACAGTGCTCAATGGGTCGGTGAAAGGCCTAGTGAGCAACGAAAAGATCGCGAATCTCAAGCTGGACAATTTTTCGAGGTTCGCTGCGCTGTTTCCCGAG
TTCAAGTTCGTCTTCTTCGGTGACTCGGGCCAAGGAGATGCGCTGTTGGCTTCACGACTGCTAAAGAATTGCCCAGAGCAGGTGCTCGGCACTTTCATCC
ACAACATGAACCCGATCTTCGCCAGAACGGGTGACGGAGGGCGGAAGCGGGCCTATACTGCGTGAGTATTTGATATGTATTTATTCTCATCGTAGTATTC
TAACTCTGGTGCGTTTGGATTTTGTAGGGAAGGTGTTGAGTTTTTCAGTACGTATGCAGGAGCTGCTCTAGCAGCATACAAGAAAGGGTTAGTCTCAGCC
GAGGACGTTCTTTCAGTCGCAAAAGCATCGGAGAGAGAGCTCGAAGAAATTCTCTTTCTTGGGCCTGACGCTACAATCACGAAGAGCATGAGACAGCAAG
AGCTACGGCAGGACATCGACCTTATCCACTCGTGCTTGAACACCAAGAATGCATGAAAGGTAGAAGTGTTTGTATCCAATCAAATTCTGTTGTCCATTGC
AATTAATTGTGTTCTTTACCAGTGATGGATCGCGAGGAAGCACGCGCGCGCATGCTGCGCCTGTGGATGATTCTTAGTGCCAGCAACTCGCCCACCTCTA
TCCACACCACTCAGAGGTTAGTTAAGCTAAGTATGCACACCTTTTGCAGCGCGTTCTCACCTGTAAATTTGCTTTTGACTGTATCATAACAGCACTGTTG
TGCATGCAAACTCCGTGATCGTCAACGGAGGGCAGACGCTTTTCGCGTGTACGAACCTGGACACACCTCTGGGTACTTACCATCATGCAGTCTTACGGGA
TCAAGACATCGCACAGTTAGCACGGCCACTGACGGATGCGGAACTGCGAGCGCTTGTGCTCGACAACATGTAAGATGAAGGATCATTGTCACCAAAAGAG
TCTACAACACATACGTTTATCATTTTCTCTATACACCTCTATCTTAAATATTGATACGCGTCTGGCGAAGCAGTGGGCCCTCAAATACGCATGGGCGCTG
GCTTCGCCGAGACAATTGGGGGAAAGTCATTAGTGCCTGCTCAACTCGTTGCGGGCGTGTCTTGGGGAATCAAACGGCACACACGGTTCGCGCAACGAGT
GAAGTTAGCAGACTGGTGGACACTTGCCCATGGATAGATACAAAGAGCAACGAGCTTGGCCTTGGGTCGTCATGACCGGAACATCACGCTTGGATCGGCA
GGATCGAGTCGTCACAGGCGAAGAATCACGGCTGCCACCTCGTTGTCATCGGAAGAAGGCACAGTAGCCGCTGGGGTAATTTCACTATTGTCGTTGTTGT
CATTGCTGCTGCCAGCCCCAACATTGTTGGTACTGCTGGGGGTGCTGCCCTTGCTACTCCACGTTGGAAGTGGCGCAGTAGCAGCAGCCAGTGGGGACTT
GCGCGTCGCTGGGAATGCTGCAACCACTTGTGGATGAGGAGACAGGGAGTCCGACGAAGACAGGGATCCCGTTTCACCACTGCTTCGACTGATAATGGAA
GGCGCGCCAGCGTTGGTAGGAGCACCCATGGTAGGCATCCCGTCATTGCTGTCTTGACTGTAGCTGGTGTCACGCAGTCGATAGAGCACGTTGCTCGGTA
AAGCAGGCCAGTCAATGACCAAGTGGCGCACGGACTGCTCCACGCGAGACTGGAATTTGCGCACGAGCGCGGCCGCGATATCTTCAGGCAGATCCGAGTG
GTGCTTGAGTGCCGTGCGCTTTAGCAGATCGACAAGTTCGGTGAACGTCAGCATGACGCCCATTTCAGCGCGCGCGTGGATCACACGAACGATGCCAGCC
TCATCTTCAAATGGGATGTAGTTTGGCTCGCAGGGCATGTTGAGCTTGTGCTGTTGGCGCTTATTAAGGCGGCGGTGGAGCGCTGCAAAGTGCACTCCGT
GGGCCTTGGCGGCGTTGCGCAGGCTCATGCCGTGGATAGCAACATCCTCCATAGCCGCCTCCCAGACCTTGGCGGGCACCAAGTTACTTTGTCTGTAGTG
GCGTTCGCTGGCATTGCTGTCAGCGTGGCCCGAGTGGCTCGAGCGACCATTGCTGCTTCCGGCGCTTGGGCTTCGGCGGAAATTCCTGCTTTCGTCTCTT
GGTTGGCGCTGTTGGAAGTATCTCAGACGCTGCTGTTGCTGTGGGAGCAAGCCATCCCCACCCCCACCGTCGACGCCCTCCCAGACGTATGAAGCAC