Description :
From Genome Similarity Track
Location :
Scaffold_66:73141- 74564
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11486Hypothetical protein

Sequence
1423 bases(100 bases per row)
TTTACCACACAAAATAGGACTATCGCAATTGGTGTTGCAGCGCGGTGACTTGTCGCTCGAGAAGCTGTTTGCTGCGAATCGCCTCGCTGTACTTGAACTT
GAGGTCTTCAATCTCTTCAAAAAGTCCAAGTCAAACGCCGAGAGCTCGTCCGAGAGCTTGGCGTTCTCTTCCAAGAGCTGCGCGTTGTGCTGCTCGAGCG
ACCGCACGATCTCGTCGTTGCCTACAAGGACAATATTGTTCATTATGTTGTCTCGACGGCACCGTACTGGGTTGGCGCGATATGGCCTCGAGACGGCGGT
CCTTCTCGTCCAGCGCGTGGCGCAATGCGCTCTCGTCGTCTCGGAGTGTCTTCCACTTGCCGTGGAGCGTTCGATATTTGCGCTGCAGCTCGGCGCTTTC
CGCACTGAGTCGCGCTATCTCGTGGCTTTTCTGGTCGAGCTGCGCCTGCAGCGTCGACACAAGCGCGTCAGGTGTCTTGGTCGTCGATGGCTTCGCTGGC
TTGAGCCGGCGCAGGCGGTCGTTCTCGGTCCGGAGCTTCTCCATTGCCCGCTTCATGTTTTCAATCACATCTTCAAGGGCGGTGACGTCGGCTCGGCTCT
TCTTGGTCGTCGTCGGTGTCTACGCCAAGCGTTCAAGCAACCCACCATGATCCTATGAGAACCTACGCGGGCAGGGGACGGCGTCATGGGCGGCGTCCGA
TTCGGCGCACGCCGCAGCCGCGCGAGCTCCAAGCTCAAACTCTCGACTTGGAACGAGAGTTCGAGGAGCTGCGTGTCCTTCTCCAAGAGTGCTTTTGCCG
CGTCACTCGCGTCCTCGGGCAAATGCAGCGCCTGGCGCGACGTGAGAACTTGCGCTTGAAGTTCGCGAATCCGCTCGTGGCAGCTCTCGAGCTCGCGCTC
TTGGTCAAGCGATATCTTGGGCACGGTGTGGGGCAGTGGCGCGGCTCGCAGTTGCATCAACTACGCGGCGCTCAACACAAAATGGCCGGTATCATTACCG
TACCTGCTCGGCCTGGGTCGTGAGCTGGCTCTGCGCGCGAGTCCACTGCTCCTTCAAGCGGTGGCATTGGGTCGTGAGGGTATCGACCTCAGCCTTCTTC
TCTTCGAGGCGCGTTGTGAGCACTTCGACCCGGCGCTTCATGCGCTTCTCATTCTCCCACTGCTTGCGCGTCGTCTCGTCGCCGCCAGATTCCTGGTTGT
TGTTGTTGGTGGTATTGGTTGTTGCTGCCTTCGGGGCGACCGGCGTAGCTTCTCGCAGCGCAGCGTTTTGAGCTTCAAGGACCTTGATCTTCTTTTGCAG
CTCGAGAAGCTGGTCGTCTTGCGCCGCGTACGTCCCGAGCTTGGCTTTGCAGCGCTGCAACTCGTCCCGAAGCGTCGCCACCGCTTGTTTCATGTCGTCG
GATGGTCGGGCCAGCTGCTTTTG