Description :
From Genome Similarity Track
Location :
Scaffold_1163:7314- 10670
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1163-fgenesh-gene-0.2Dual specificity protein phosphatase
Pytiw_DAOMBR242034maker-piw_contig_1163-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
3356 bases(100 bases per row)
TGATTACCTCACATAGCGGTGTTGGTAGCCCTGCTTCAGCTGCAGCAAGTTGTCGCCCTGGGTCTTCTCCTCCGACTCTTTCGAAGTCTGCACATTCCCG
TAATGAGGCAGTGGCTTGCTGTTGCCCAGCCCACTGCTGAGCTTGCTGCTGGTACTTGGAGTTGAATCTTTCGCTGTGGAGCCGCTGGGCTTGCTCGCAG
TCACGTCGGATTTGCTGGAGCGCAAGAAAATGTTAATGCTGAACAGGCTCGTGGACGTCTGCTTTACCAGCCACTTGCCAGAGCCCTCAGATGATGAGGC
AGTGTTGCACTCCTGCTCTTCCTTCGCTGCGCGCCACATCTGGTGCTGGATCGAGTCCATGAACTGCTGCTGTGGGCCGATGACGCTCCCGGGACGGCAG
ATGCGCAGCCAGCCAATTGTTTCCTTTGACGTGAACTTGTCGTGCTTCATCAGGTACGCGCCGATACAGGTGCCCGTGCGTCCGAGCCCAGCCTTGCAGT
GCACTGCCACTGCACCTGAGGTTTGCTCACACGCGAGGATGAACTGCTTGAGGATGAACTCTGGCGGGTTTGCGCCATCGGGGTACAGCAGATCCAGGTG
GTCGATGCCGGCATTTGTGAAGCGCTTCTCGTCGTACTGCTTCTCGTTTAGACGCACCACGAGCGTCACGTTCTTCTTCTTGAAGTACGGGATGTAGTGC
TCCGGCGTGAGCGTGACGTACCCGTCGGCACTCGCCGAGAACATGTCGTGCGGGCCAGCAAACGCAAGGAACTTCGGGGACACCCAGCTCAGATCCCCAT
TCTCGACCTGCTCGTAGTGGTGGTACTCGCGCACGTCGAACTCGGTCGGGCTCACGTATTTGAGCTGCACGGCCTTGAGCAACCCCTTGATACAGTCCAG
GATCGTGAGCTTGTACTCGCACGCGGTCGGGCTGGCGTCGTGGAACGGAGGGAAGGTCATGGAGCCGAACTTGGCCACAGCGTCTTCAGGTCGCATGCCG
TTCGAGAGCACTCCCCAGCAGCAGAGCAGGCAGGCGGCGTTCGCTCGGAAGGTTGGCTTGGGCGACGAGTAAAAGAAGATCTTGCGCTGAGTCTGCAACG
CCGAGTGCACCATCTTGCTGAGCACCGTGCAGAACTGGAACGTGCATCCGAGGTTGAGCGGCCCAAAGTCCAAATAAAAGTTGTTGTAGTGGAGCTTGTC
GTCGATCGAGAAGTAGATGATCCCGTCGCATGGTGCCGGGTCGGCGACGACGGCGGTGTAGTACACGAGACCCGGCACGAATTCGATCACTGGCGCGGAC
TTTGGATTGTTGGACAGCCGACGCATGGCTTCAGTTTATTTTCTGCAGACGACCTTGGGCGATATAGACTATCGCGAACCCCAAGTGATTCGAGAATGCT
GCTGCTTGTGGCATTGACGTCCAGCTCAGCGCTTACTCCGGACGTCGTGAGGCGATGTCGATCTTCTTATCCGCGCAGATAGCACCCAGTAGCTCACACG
GGATATCAAAATCCTCGCTTGGACAACCTGCTCATCAGCACAATCTTCAAATCATCAGAGTCAGTACCATGGGTAGAGTGCTCCAGGCTAAATTGGGGGA
AAGCTCTTGGATCCGGATCCGAGCGACGCTCTTGGCGACCCATGTCTTGTCCTGCGAGCGCGTGTATCCAAACCCGAAAATCCATTTCCGTACTCCAGGA
GGTCTTGTCACAGCTTGAGGCTTCGAGCACAGCGGGTGTTATATTTATCATTCTCGTTAGCCGGCGCTAATCTTTGCTCGCTAAGAAAGTTGTTAGATGT
GAGAGCACGGACCTGGCAATTATTTTAGGAGGCTTCATCATTCGTACCTCCGATGCTCACTGTTCTTGGGGGGGAAATCTTCATTTTTGTCGTCTTGAAG
GGAGTTCGAATCACTTTTTTTGTTGAGCTTTAGAGCAGGATCTCCATCGAGTTCGTCCATTTTTCCCAGCTCCGAGTCCGCGATCTTGAGAGAGAAGCGC
AGCTTCATCAGGCGATGACGAGCTGGTCTTCACTTCCAATAGGCTCCTCACTCGCTGGCGGGACGACTCATCTGGCTTGAGCAGGAGTCGCCGTCTTGCT
CTTGTTTTTCTTCTTCCTGCGAACTGGTCGTCCGCAATTTCTCGAGATACACCAACATACATACGCACAGTAGCCGAGGCGCTCGCGCGATCCATTCGTC
GTCGGGTCGATGCCTGGCTGAATAAAATAATTGTTTTTGCTGTCGCGCTTGGAGCACCCCTGCCGAGGTAGTGATGCCACCGACAGCGTACTTAGATACC
CGCGGTGGAAATCTCTTCCTCTGGACGTTGCATTGAAGCGCGCTCCGCTCTCGCAAACCGCTTCTGCGCAAACGCCATCCACCGCCCTCGGACCTGCTTC
TGGACATTCTCCACCGCAGATGTTAACCGGCGGGTGCGTGCGACATCCGACTCGTGCACGTAGACGATGTCGCTCTCGCCGGCCTTCGCCGCGTTCAGAC
GCACTGTGTAGATCGCGTCCTCGGGTCGCAGAGCCTCCACTCGGCCCGAGCCAAACTTGGTCGTCACCTCCATGCCCACAAGCGCCTTTGGGTAGAACTT
GATCATGTCTGCATTCAGGTACGCCGTTGCCCCCCACGTGAGCTGCACCTGCACCGTCTTCTGCACCGAGTCCAGCGCCGTGATGCTCCCAGAGCCGAAC
GCCGTGATGACACACTGGCCGTTGTAGTACTTGTTGGAGACGAACTGGTACGTGGACGCCGAGATGCCCGAGGACGTCGAGACGATCGTCTTGAGCGCAG
TCGAGATGCCCTTCTGGATCACCGATGACGGCGCGTTGCCCAGCGAGCTGCGTCGCGGACGCACGTAGCGCTGCACGTCGCCCTGTCGGATGCGGCACTC
GTACTCGACCTCTCCGCCAATGCGGACCGCGTACATCTGGTCGTACGAGTCGTAGCCGAGCACGCAGCCCTCGCCCGCGGGGGTGCGCACCCAGTCGCCC
ACGAGCGCCGGCACGGAGTAGTACTCGTCGTCGTCGCCCGCCGTGTAGAGCATCATCGGCGGTCGACTCTGCAGCTGCACGGCCGTGATGCCATCGCCTT
CACGCACCTCAATCACCGTGCCGAGGCCAAACTTGGTTGAGACGACGGTGCCGGGTGTGAATGGCGCAAAGTCGCTGTCGGAGAAGTCGCTCACGCTGCG
CGAGTGCTGCTTCTTGAGCGAGGGTGTCGTGGCGGAGGGAAGCCCGAAAAGCATCTTGGAGCTGTTGAGTCCCGCGCGCGCGTACGAGAAGACCGTGGCG
CGCAGCGGCGGCTGGTCCTGGTCGAAGCTGAGCGTGTGCGCGCGCCGCATGGAGGG