Description :
From Genome Similarity Track
Location :
Scaffold_373:7310- 9505
Transcript NameFunction/comments
Phyag_g5145hypothetical protein PHYSODRAFT_501248
Phyag_g5146hypothetical protein PHYSODRAFT_300142

Sequence
2195 bases(100 bases per row)
GACCAGTAGTAAGCCGATGCATTTCATGGGGCGACTGTTCTTCTGCGTTTCCTCGGCCttttccagctcctcgatgcCCTTCTCGGTTTGCTCCACCACT
TGCTCCATGTTGTAGTCGATGCGGTCCAGGATGGTGCCCTGGTCGATGACGAGCACGGCAAGCTCTTTAAATATTgtcgccagctccgtgaTGGATGTGG
CGATACGCTGAATCTCCTGGTCGCGCTCGTTGATGACGTCCTCggcgatctccacctccgtgACCTGGGCCTGAGTGAATCCCTGTAGGTAGCAGCATCA
CGCATCGTCTCACAGCATTAGATCGCGAATTCGTCTTCACTTgtaggcagcagcacgacaacAACTTACCGAATCCGCTCCTCCACGTCGTTTCTGCTTG
GCATCATTCTCTGCAAGGAAGTCGAACTCTACGGGGCCCTCTTTCTGGTGTTTTACGCGTGCGAGATACGTCTTCTGCGACTTTCGGAAGTCGCCCGACA
GCGTCTGAAGCTGCGTCGCCAATGCTCTGCTCAGCAGAAGACATGCACCCCGATCGTCAGCCACACCTACATACACCCCTCCCTCCTGTATCCTATACAA
TCAAAAACTCCTTCCTCCCCCACACGAACCTCTGTACATTTTGCCTCGTTTTGGCGTCAGCAGCCGAGAATTCCCCGCTGCGATCGCCCTGTGCCATCCG
CCGCAGCCCCTTCTCGGCGCTACGGAACTCGTCCGTGATCTCCTGCGTCACGTGGTCGATCTCCTGCTCGTACTTGGACTCGGAGCCGTCAAATCGCACC
ATGAGGCGACTCGTATGCAGTTtgttcagcttctccactgcaaataatacagcaacagcaccagaGTCAGTCTCTATCTAGTCtttccttcttcatctgg
ccACGTACTCATCTCCTTGATGCGCGCCACGTGCTGGTTGGTGCCGTTCACGACGTCCACCCACCCGGgggcgatggcgacgctCGTGGCCTCCATCTCT
GCGCTCTTCATTAGCGCATTTCCTTCTTCGCGGTGGCTCACGATGTTCTTGCGTCGCAGCACTTTGGCCTTCTCATCTGcacgcagctgcaggaactggc
GGGTCAAGTCTCGCGTCGCCATGGCTGTCGCTCTCTCGCTCTCTCCCTGTCTGAAGTGGTTAATTACGTCGAGCGCTTATCCTAGACCGCCCTTGGTGTC
CAGCAAGCCACGAAGTCTGCACTTCACCTTGCGCCCGTGTGCGAATACGCGCTGGCTTCAGTATTCGCTGTATTTTTAGGCACCTTTTTGGCACTAAAAT
CAGTGTGTGGCAAACACAGGTTTTGGGTGCGCGTGGTTGAAGTGCGCAGCGGATGGTGCTCAAAGTGGTGGCACTCTCCAATCTTCCCTCTAGGGCACAC
ATGCGGGGGCTTCGCTTGACAATACTCGCGCTATTAGCGAGCTTTAcctgctgcactgcactgGCCAAGCGCGTCGTGCCGCTTGACCGCTGGACCTTCC
ACTCTGCCAACGGATCCGTTCGTGTGGACAATGCGTCAGTACCCGGCACCTCCCACGTCCACTTGATGGGGGCGGGGATTATTGGCGACCCGTACTACCG
CTTCAACGAGAGGGAATATCAGTGGGTGGCGCAGGAGACATGGACGTACGAGACGCACGTGACGTTATCGGGAGGCGACACGAAGCCGCTGCTCGTattc
gagacgctggacggTGTAGCACGTGTGACGGTCAATGGGAAGCAGGTGGCGACCACCGCAAACTCCTTCGTGCCATACAAAATCAATGTAGCTGATGTGT
TAGTGGTGGGTGGGAACCACATCCAAGTGGAGTTTCAGCCGGCGATGCAGTACGCCAGACAGCAAGCAGCCAAGTATCCGTATTTCGTCCCGGCGACCCA
GAATTTTAACACGTGGACGGAACCGACCCGCCGGTCATTTATCCGCAAGGCAGGATCGGATTTCGGCTGGGACTGGGGCCCGGCGTACGTGACGTCGGGC
ATTGCTGGGCCGGCCTATATTGAGTTTGAGCAGCCGGTGGTGACGCTCAAGGACTTGCATGTGGTGCAAACATTTCCTGGTGGCAAGGAAGACCTCTCGG
TTGTGGATGTCACTGTCAGGGTAACGCTGGACGGGGGAAACGTGAAACACGATAATGTCACGTTCGACTTGTTTGTCAATGAGAAGAAAGAGACT