Description :
From Genome Similarity Track
Location :
Scaffold_1449:731- 4375
Sequence
3644 bases(100 bases per row)
TGGCCGGTCTACGGGCCAAGTTGAAAATCAAGGATGGGGGATCCAAGGTACTGCGGGGACATGTGGATCATTTCATCGAAACGTTGGGAGACGTGGATCT
GGCTGACAGGCTGACCCTGTTACGTCTTCCCGACGCAGATGAGCTTGAAGAAGTGCTGCGGGCTGTGGATCGCGCGAAACATCGCCAGAAGAAGGCGGCG
GTCGGATCCGGCAAGTATCGCTAAAAGGCTCCGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGCGGAACTGAATCAGGATCCGTCGGTTC
GGACTCCGACCCTGAGGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACTACTCTCGACCGGGGGATAACGTACCC
GGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCT
GGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAA
GTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCTGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTAG
GACGCTCGCCGGGTTTGAATCTGGTACGAGCTGAGCGTTCTAGATATTGCATTTATGCATTTGTATACAAGACAGCGCTAGATCCAGGTAGCAGGACCCT
AGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTTTCTAGTTTGCGCGAAGTGGATGAATTTGCCAGATCCGAAGTCTCTTCA
ACCCTGGATCTACAAAGGGGGGAGCGCGCAGTTACTGGGAGAAACGACAAGATGGTCAATGGTTTGAGCCTATTAAGGGTGAGGTCACTGCAGATCCACC
CCAGGTTTGTCAGGTCACTGGATCCCGCGGATCTGAAGATGTTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGAATACTGGAAGTACCATGCCCCA
GGAAAATGGCTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCAACTCCTCGATAGTGGTGCCGAGGTGTCTATACTAGATACCG
CCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTAGTGGAGGCATGTACCGTACGAATGGAAGAACGCGGAT
CAAGATCACGCTGGCAGGTTGTTTGGTATACTGGTTCGATATTTGGGCTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCG
GCCGGAGTAAGGTTGGATCTGGCGGATGAGACACTGTGTTTCCCGGATGAGATGCGGATCCAGCTCAGCGGACGTCGACCGTTGCACGGGGCGAAGATGA
GGATCATAAGGGCGGATAAGACGACCTGGATTGAGCCCGGAGAAACCTGGGGGCTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACGGTGGGTCAC
TCGGGGTGAGAAGTGGGTGCCAACAGTAATCCAAGGACCAGGTCGATCACAATGCCTCCAGGTCACGAACGTCAGCGACAAGAGACTACTACTGGACCAT
TATGAGGAGGTTGGGCGATGGTTGGTGAAGGATGGTATCCCTAGGCGACCTGAATATGTGTCAGTGGGATCCCATCGCTACAGAGAATGGCAGAATCTGG
CGTGCGAGGCGACTACCGAGATCGAATCCCTCGCGGACGTGGAGCTCCCGGCGGAACCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCTCG
AAAGATCCTACAGAGGGATCGTCAGATTGGTATCCAAGTGGTAGAGATTGGATCCAAAACCGCTGGCGATACCCAGATCCGGTCCTGCGATAGCCCAGGG
TTTGTCGAGAATGGCAACACCGGCTTACCAGGAACCGTCGTGTGTAAACTCACCAGAAGGTCAAGTCGATCCAAATGGTAGTCTCCCGGTACCAGGATAC
CCGATCCCATAAAGACAGAAGGAATGACGGGTGAAGGGGAGTCGCGGTGCTTGGATCCAGTAGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTA
CCATGAAGGCGGGGATCTACACGCTGAAGATCTCGGAGAAGGTATGGCGGTGATCCCGGAGATACCACTGACCACAGAGGAGGTCACGATTGATGATATC
CAAGTAGATCCGGGGGCGAACGAACCCGCGGAAGTGGATCGGCTACATCAGAAGATCTGGGAAAGCCGACATCTGCTAATTGGCAAAGGACATGCATTAC
CACCAGCTACACGTGGAGTCAAATGCGACATCGATGTCGGTGACGCGAAGCCGATCGCTCAAAGGGTGCGGAATGTGGCGCCTCAGGTCCGAGAAAAACT
ATAGTATCTGATTAAGGGTCTGCTGCAAGCCAAAAGCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCGTTAAGAAGAACGGAGTG
GATATACGTCTGTGTATTAATTACCGACTAGTGAACGGCCTGACCCGACTGATGGTGTATCCAATGCCTCTAATCAATGAGATATTGGAAGATTTGGATA
AAGTACTCTGGTACTGTTATCTAGATATGGCCAGTGATTTATGGGTGGTGACTACGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCATTTGG
ACTGTTCGAACGGAGCCGGATGCCGTTTGGATTGAAGAATGCACCCCAGATCTATCAACGCCTGATCGATAATGCCCTCTACGGAGTTACCCGAATACCG
GAACCGGAAAGAGGTGGACCAGGGAAAGGTCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCA
GATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTC
TATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGTGTGGTGTAGCGGGATCAGCAAAATCTGC
GAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCTGTGTTCTGCTGAACTTTCCTCACCTTGTGTA
CCCGTCGGTAGGGCGGGATCTTGCTCTATCGGTAACTTCCGAAGCGTTCAAGTGGTGAGGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAG
CAGTGGAAAATCTTCACTCTGCATCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGAATCTGGCCGTAGG
GTTGCCTTACGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAATTGAGAACCTCTAGGGTGTA
ACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAA