Description :
From Genome Similarity Track
Location :
Scaffold_567:731- 4300
Sequence
3569 bases(100 bases per row)
TCCTCCCATCGATATGACCGACTCACATCAAGGGATCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCG
CAAGAAATCATAGAGTAATGCTCCGCAGTTCAGATCTGCCTCGTCTACCCAACTTGGTTCGTCATATCCGCGCCAATACACTAGAAATTCACGGTAAATC
CGTCCGTATCTAGTTCGTTTTCCTGACCTCATATCGGTGATCCTCTCGACTTCGAAATCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGA
GGACTTCGTCGAAGTCGACGCGGTCGGATACATCCACTGAAAGACGGATCTGTGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTTTAC
CACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGTCATAGGTGGGCT
AATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGTGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCG
CTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAATATTTCTGGACTTGGTATCGCCATCGTCTTAGATCTCGGTT
CCTCTTCTTGGTGCTGCAAACTGGGATTGCCGCTTCCAGGGAGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTGTCACCCCGGATCCTGTCT
TGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCT
GCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCGGA
CATAAAGCCTGGCTCCCGATCATGCCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTA
GACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGAT
CCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTATCTCACAATCCACGCATTC
ACCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGG
CTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAAATCCATCCCGGTCCTCGTTGACTCTCTTCGTAGGGGGG
CAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCA
GATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGG
GTTGGATCGAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTA
ACGGGATCCTGATGCTCGGCCTCTCTCTCCAATTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCT
TGACATGCACCAACTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGAGGCCTTGCAGTCAATCTCGCCTCG
CACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAACCTTTTCGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCC
GCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCCCCTCCGC
GTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTT
AGGAGCGACCTTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCACGGCCAAGCCTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACA
ATCTCCAGTGTCCAAGGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCA
GGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGGTCCAACACGCGCAGGAACGCGAGTATCTCTTTCTCCACTGCTCCGTAGTTCAGTTCATT
CGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCCGCTGAGATTGCCCAGTCACTGGCATAAACTATC
ACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAG
ATTCTGCCTTTTCCATGTTCCGATCCGTCGTTTCTATCCAGACTGGATCCTCTCTCCATTGGTCCCGGGGTAGATCCAGCTCCTGTTTTAAGTCCTCTTC
TGTCGTCGTACCACTTGGATCCCTTCGTGGATCCGACATATCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCGGCAAAA
TCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTTCCCAAGAAAGATTGCATCGCCC
GTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAAATCGATGGCCTAAGTACTCCACCTT
ACGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCAATCTTTCGCACAACTGATCCCATGAT
TCCGCCGGGATCAGAATGTTGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCAACTTCCG
TATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGACGTTGGTAGATCTGGGGTGCGTTCTT
CAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGATC