Description :
From Genome Similarity Track
Location :
Scaffold_51:731- 2462
Sequence
1731 bases(100 bases per row)
CTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTG
AACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTACTCAA
ATTCAGGGTACACCCGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGCTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATG
GCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTGCAGCCGGGGCGGCTTTATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTA
CGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTT
GGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCA
CCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTT
AGGTCGGGAGAAGACCTATGGCTCGGTGAGCTTGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAA
CGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTC
CCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCAATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGAACACCATTGATGGTGAAGG
TACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTTTGGACG
TCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATA
CCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTA
CACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGGTGGGGGAGGGATAGCCGAGCGGCTA
GCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCC
AAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGACGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCCACCTAC
TCATGCAGTGTCTGCTGTCTTCAAGACGAAGTTAAGACCTCGGTTCATAGGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTT
CCGAAGAAGATGCGCACGCATCCAGTCTTCT