Description :
From Genome Similarity Track
Location :
Scaffold_4229:731- 2397
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4229-snap-gene-0.1DNA repair and recombination protein RAD54

Sequence
1666 bases(100 bases per row)
CCTTCTTTGCCTTCGACCCCTTGGAGTTCGCATTAGAAGCTTTAGCAGCTCGTTCCTTTGCCGCTGCGATCTTCTCCAATCGTTTTCGCTTGCGCTCTTC
CTCTCGCTCATTCTCTTGCTCTTCCTTTTCACCCATGTGAAAGTTTTGGAGCAGTTGCCAATCGACACGGCAGCTGAACGCAAAACTGACAAGATCTTCA
CGCAAGCCTTCAATGGCGTGCTGCATGATCTCATCGTCAACCGAGTCGTATCCACGATGGTGACCCCAACTGTTCAAATCCTCTTCAGGCGGCATCCCGA
TCTGTGGATGATAATGCTTCTCACTCTCCTCGACAGTCGTCTTGTCCTCCAATTCGCCATCAGCGAGCAGGTTCTCGCTGTTATCATCATCATCGATCTC
GATCACATCTTGGATTTTGCTGTTTGCCGCATCCCTCGGGTTCCTCCATTGGCAGCGATCGCACTTCAGTTGGTCGTGCGTGTCTGACAACGTATCCTTG
TTGAACACGAAGAGCCGCTTTAGATCCTTCGATGACAGCGAGTTGACTTCTTCTTTGTCGTCGACGATGTTCTGCAAACCTTCTTTCGAGAGTTGGCGCT
GAAAAATCTTCTCTTCCAGTGTCCCCGTGGCGAGAAAACGATAGACAAAGCACATTTTCTTCTGGCCTTCTCGCCAGACACGCGCAGCCGCTTGCTTGTC
GGTTGCTGGGTTCCAATCCGGGTCGAAAAGCACGAGACGATTTGCACCGATGAGGTTCAACCCACAACCGCCCGCTTTGCTCGACAGCAGGAAGGCAAAG
GAGTTCGTGTTCGGGTCGTTGAACACGTCGACCAGATTTTTGCGCTTCTTTGCCGACGTTGTGCCATCCAGTCGAACAAAAGGCAGCTGGCGTTCACGAC
AAAGTGACGATACCACGTCCAACGTTTGAGTGTAGTTCGACACGATCACGATGCGGTCGTTCGAGCGTTTCCGCATTGATTGCATGAGCCGGTCGAGGAG
CAAGAACTTCCCGGACCATTCAGGGTGGCAGGTACGATCATGGCCGGAGCGACCTCGGTAACCACCAGCTTCTAACGAGATCGATGTGGAGGATAGTGCC
GATGCGAAGTAGGGAGAGCAACCTTCAAAACCCGCTAGCTTTGTGTTGCTCTTTCCTGACTCGTCGAAGATCAGAAGAGGGTGGTTGCACAGCTTCTTCA
GCGCAGTGATAGAAGAAAGAACGTTCGCGCTCTCCTTGCGCATCATGGCTCGGAACGCACTGGAATCCAAGAAGTGCAGATACAGTTGCTCTTGCAGTGG
TGACAATGGGCAGCACACGACTTGCATGAGCTTGGGTGGCAAGTGCTTTGCGTTGAGAATGTTGCCACGGCGCAAGATGAACTGGTTCACAATCTCACAC
AGCATCGCAGAACAAGCTTGGGCAGTCTCATTCTCTTTCTCCGTGGAATCTGGTTCGCGTCCCACGAGGATCGGGCCGAGATACTGCTTGCGGAATTCGC
TTGGTGTGCCGAGGATGTTGGGGTTGGTGAAGTCCACCATCGCAAAAAATTCTTCCAGGTCATTTTGCATTGGTGTGCCCGACAGCAGCACACGCTTGCG
GCATGCGAGCGATGCCAACGCACGATTGATCTGCGAGTTCGCATTCTTGAGACGATGGGCTTCGTC