Description :
From Genome Similarity Track
Location :
Scaffold_1837:731- 2251
Sequence
1520 bases(100 bases per row)
GGTAAGCAGCCTTGCCGCCTTCGCTCGTTATCCAACAAGGCACTCCCAAGTTGTTCACTTCCTATGCTTTCAAATCCGTCGTAGAAACGTGGAaagcgct
ggcagcgaaTAGAATTCTGAATGTACATGTTCATCATTGAAATCCGATCAAATGCGACCAATGCAAAGAGTTTATCTTCAGCAAACTGCCGCTCACTCAA
CGTAACCAAGTGCTTGATACATTCTTCAAATAAACTGGTTCTCTTCGACATTCTCCAGGGTGACCACGACCAAATGGAAAAAGGTGAGGAAAGATTCGCG
CAAACAAATCGTCAGAGACATCATGGGAAAACCTGTTTGATTGTCGAATCATAAGTCTCGCTCAGGGGGGGCTCATGATCCCGAGCTGGGGCTGCCAGCG
GATGATTGCTCGCCCTAAGCGGCGATGTATAATCAGTGAGACCGACGCGTCGTTCCAGTACAGCTAATTCGTCATCAGCGCTCCTAACACGCCACGAATC
CGATCGACCACGAATATTCTCCAACTCAGCATTAATTCCATCTTCGTAGTGTCCATCACTATCTTCCGAGTACTCAATAAAATTGTCGCCTACCATATCA
TCGGGGTATTTGGCGTTCAGCACGTCGGTGTTTGTAAATACGTTCTCATACAATACATTGAAGTCTTTATAGAAGTTAAACACTTCTCGTACGACTTGAG
ATCGAACTTGATGCGTCTTTTTGACTTTCGTCAACTGTCCTTCTGTAAAATCGCCACCCATAACAACACGACACGACGTCCCATCGCGAATCGAACGAGG
CAAGAGGGTAATCGGGGGTCCTGGATTACAGTCAAAAGCGACGCAATGTGAGCGAACACATCGGTGACGTCCGCCTCGCACCACACGTGTCATTGCTCCA
ATAGTTGCCAGTTGAGTAATAAGCCTTTTCCGGAATAGTAAGCGAGCTGAGATGTTCTGGTAATCTTCCACACAACAAATCATTTGCTATAGCGAACACA
GGAAGCTTTTGGGATCGAATACAATCATCGCATTTTTTGCAAATCGACATCCAAGCATCAGGGTCGCCATTATCATCGATGTAGCAGTGAACACCTCGTG
GAGAAACCAAGACACGTTCCAAACCCTGGATATGTGGTGGGCATCGATATTGATCTCGTAGCGACTCCGGTAATTTATCCTCGGTTTTACCCAAGCACTT
GTACAACTGATCCACATACTGCCGGTCGCCACCCCCCTTTGTCACTGTATCACGCCGAAGCACTAATCGATCACACACcaaacagcagcatccgTCCAAT
CCGTCAGCTCCcagttcttcttgaagaagcTCCATACAGTGACGTTTATCTTCTTCACTCAATGGATGTAAAAATCGGCTAAATTATTCCATAACGTTCG
CACGTATCTGATTAGATGGACATTTCTCCAACTTCTTGCGTAATCTTAACTTCCGTCTTTGTGCCTTCCATTGCTCTCGTTGGTATACAACGTCTAGGTG
CAGCAGTAAGTCATCTTAAT