Description :
From Genome Similarity Track
Location :
Scaffold_139:73090- 78641
Transcript NameFunction/comments
Physo_143446predicted protein

Sequence
5551 bases(100 bases per row)
AATCGAATCCGCGACGGACGCCATGGCCGACGCCGGGTCCTCGGACGACGCCGAGAGCGCCACGCTCACCGCGCTCTCGAGCTGCGTGACGACCGTGATC
GAGAACGACCTGTCCTACGGCCTCTGCGTCACCAACTCGGGGCTCTTCGACCTCCTCCCGCCCGACTTGCTCGACAACAATGACAACAACTCCAGCTCCT
CCTCTTCCTCCTCAACGTCCTCGTCTTCCGCCAGCTCCTCGGACGACTTCAGCGGGGACTCCGTGTGCCGCGTCATGTGCTCCAAGCAGTCGTCCAGCGC
CTCGGCGTCGTGCTGCGCGGCCGCGGCCTCCCTCCAGGCCTGCAACACGTCGTCCAGCGCTGTGGCCTCGTGCAAGGAGCTCTTCGACAGCGTCTTCACG
TACCAGAGCGAGTGCGACGGCGGCCTCTCGACCGCCAACTCCCTCCTCATCGCGGTGGTCGCCGTCGTCGTGGCCGTCATCGCAGCGGTCGCGGTCTTCT
CGCGTCTGTACGCGCGCAGACACAACAACCAGAACACTAACAACAGCAAACTCCAGACGCTTTCAGCCTATAGGGGGCCCGCGGCCCGCCTGGCGCAGAC
GTGGAGACAGGTGACCAACCTCGTGTGGAAGAACATGGTGCTGCGGCGCCGCCGGCCCGTGTCTCTTGTTGTGGAGCTCTTCCTGCCCGTGCTGCTGTCC
ACGGCGCTGCTGCTGCTCGCCAACCTGGACAGTTTGTCGGGCGGCTGGCGCTCGCAGTGGTTCACGTCCGAGGCGGCGCAGCTGGAGGCCAACGAAACGC
TCATCTGCAGCGACCTGGCGGTCTGGGGGCTCGAGGCCATCGGCGGGCCGTCCTCCACCATGACGTCCTTCTACACGGGCGGCCAGTCGGTGCTGGGGCT
CTTCTTCCTCGTGAGCTACATCAAGTTTGTGTCCACGACCACGACCACCATGGTCATCGAGAAGGAGAACCGCCTGCGCGAGGTCATGAAGATCATGGGG
CTGTCGGACGCCACGCTGCTGTTCTCGTGGTGCCTCACCACGGCGGTGCTGGCCACTCCCTTGGCCTTCGCCATCTCCGCCGAGCTCAAGTACGGCAACG
TGTTCCCCACCACCGAGTATGCGACGCTCGTGTTCCTCTTCTGGAGCCTGAGCGTGGCCATCACGGCCTTCTCGTACTTCGTGGCGCCGTTCTTCAACAA
GTCCCGGACCGCCGCCATCGCGTCCGTTTTGCTCTGGCTCATCCTGTTCTTCCCTTACTTCGCCGTGCAGTCGGCCGACACCAACGCGCCGCGCTACTGG
GCCGCGCTCTCGCCTCCCACGGCGTTCGCGCTGGCAGTGGACGAGATTCTGCGACGCGCGCAGCTCGGCACGGGCTTCGCGTACTCCGTGGGGCTTCGGG
AAGAGCCTGTGACAGTGCCCAGCGCGTTTAGAATGAGTTTGTTTCTGATCCTCGACTCTGTGATCCTTGTGGCGCTCGGATGGTACTTGGAGCAGGTTCT
ACCGCAGCAGTACGGCGTGAGGAAGCCCTGGTACTTCCTGTTCACGAAGAGCTACTGGTTTAGTAAGATTGATGACGCCCCTGAAGACGACGTACCATCG
ACGAGCACGGATACTCACGCGCTGTCGCCTCAAGCCGGTGGGGCCTACGCGCGGCTGGTGGATGGAGTACAAGGTCCAAGCGCCAAGACGCCGGAGCAGG
TGGCTGAAGATGCGACTGTGGAGCCGGTCAATGCGGCGCTGGCCATGCAGGAGCGCAACGGCACGTGTTTGCAGATCCGCGGCTTGAGGAAGGTATTCCC
GCTGGAAGAAGACGGCGAGGAGCGAGTGGCGGTCGCTGGACTGGATCTGGCCATGTACAGCGGACAGATCACGGCGCTGCTGGGCCACAACGGCGCAGGT
AAGACGACGATCATCTCCATGTTGACAGGTCTGACCCCGCCCACGGCAGGAGACGCGACGTTGTACGGGTGCTCCATCAAGCACGACTTCCAGGAGCTGC
GGAGGGTTATCGGCATTTGCCCCCAGCACGACGTTCTGTTCCAGGATCTGACGGTGGAGGAGCACCTGCTGCTCTTCGGAACCATGAAGCACGTGCCGCG
AGAGAAACTGCAGAGCAGCGTGGACAAGATGATCGAGGATGTCGGACTCACAGAGATCCGTCACGCGCTCGCGAAGACGCTTTCTGGAGGCCAGAAGCGC
AAACTCAGCGTAGCGCTCGCGTTCCTAGGCGGCAGCAAGCTCGTCTTCTTGGACGAGCCCACGTCGGGCATGGACCCGTATTCCCGGCGCTTCACGTGGA
ATTTGCTCCAGCAGAGCCGCGAGGACCGAGTCATTGTTTTGACCACGCACTTTATGGATGAGGCGGACATTCTGGGCGATCGCATCACGATTCTGGCGGA
CGGCCAACTGCGTTGCGCTGGGTCATCGCTCTTCCTGAAGAACCGCTTCGGTGCAGGGTACAACCTGACTATGATCAAGGCGGCGGACGGATCGTGCCAC
GTGCAGTCAGTGCAGAACTTCCTGAAAAAATACGTCCCCGATGTCAAGCGCCTGAGTAGTTCCGGCTCGGAGCTCGTATTCCAGCTGCCGACTGCGTCGT
CGGAGGCATTCCCCGCTATGCTGGAGCAATTGGATTCGGAGATGCATGAGCTTGGAGTGCAGCAGTACGGCATTTCGGTGACTACGCTGGAGGAGGTTTT
CTTGCGGATCTCTCAGGACCATGAAGAGGAACAGCGTATGCCGCCTACGTTGGATCGAAAGCCGTCCACGTCTGTGCTAGACCGTACCACGTCGTTGAAG
TTGGTGTCGACAGGAGGAGCGGTAAACCTGCCGTCGACTGCGCCTCCTATCACTGAGCCGTCGATGTGGACCCAGTACTCTGCGCTGACGAAGAAACGTT
TCCAGATCGCCAAGCGAGACAAGAAGACATTGGCCTACTCGGTTGGGATCCCTCTCATCTTCCTGATCATCCTCGCAGTGTTACCAGAAATTGAAGTGGC
AGATTTCATCCCAAACTACGCCTCCAGCCTCCCCACGGAATCGGAGCAGAGCACATGTGCGGCGTCTACGAACTTCAGCAGTCTCATTGATCCCGACTAT
GATGTCTCGGCGTGTTACGGCTCCCGGGGCTTCGACTACTGCACCCTCGGGGTCGTGAACTGCGATGTCAACGTGTGCTGCGATGCCACTAACGTCGCTT
CGCCTTGGTACCCGTGCAACACGTGCGGCTCGGCGCCATGTTACAACAGCAACTGCCTCGCCAAGAACAACGCCAAGTTGCAGGTGACTTTAAACGGCTT
CTTAGTGGCTCTGGTCGTCATGCTGGCGTTCGCGTTCATCCCCGCAGCTATCGTGGCTTTCGTTGTTCGTGAGAAGGACCCGATCCAGAACGCCAAGGGC
CTGCAGCTCATCAGTGGCGCCAATGTCTCCGCGTACTGGATGGCGTGCTGGACGCACGATGTCCTCCTCACGATTATCCCCATCGTCGCCGCAGCGATCA
TCATCCCGCTGTCCATGACGCCGAGCGGCGCAGCGAACGCAAGCACAGCCGATGTGTTCGCCATTATCGTGCTGGTGATTGCCCACGTCTGGGCCATTAT
CCCGCTGGCCTATTTGTTCTCGAGGAGGTACGTCAAGCACGCCGTGGCACAGACTGCGTTGCTGGTGTTCGCCCTCGGTACCGGCGGGTTGTTGAGCATC
TTCTCGTTCATGTGCCGCATCGTCAACTTCACGATCTCCGGTACCTTAACGCTGTCCTCCCTGGACCAGAACTACCTGCGTTGGATCTTCATGATTTTCC
CTGGGTACACGCTGAACAACGGTATCTTCGAGCTGGCAACGCGGAAGGTTAGTCGCCGAGCTCTGTTTGGTTCAGCTCGTTGGATGCCGGCGTCTCCGTC
GTTCTTCGGGTTGTTTGAAGGCTTCGGCAAAGAGGAATGCACGGAGTGCTGGGACCGCCTGACCCCTTCGTGCTGCGTACGACAGCCCTTTGGTATCGAG
ATCATCGGTGCCCCGCTGTTGTACACGCTGGTTGAGGCAGCAGTGCTGACCGCACTCGTGTTCGTGCTTGAAAACCGCTCGGTCAAGTGGAATCAGACCG
CCTCGGAGAAGCAGCATCATAGTGCGGTGGGTGTGGACTCCGACGAGGCGACAGAGGAAGAGGATGATGACGTGCAGCACGAGCGGCAGCGTGTGGAGCA
CGAGCCTCCTCAGCCGAACGACCTCGTCTTCATCCGGAACTTGCGCCAGCAGTACGCCGGCAAGCCTCGGGCCAAGGTCGCGTTGAAGGATTTGTGTCTG
TCCATCAAGAGCGGCGAGTGCTTCGGCTACTTGGGTATTAACGGCGCCGGCAAGTCGACAACGATGGCTGTGCTGACGGGACAACTGGCGCCCACGCAGG
GCTTCGTGACTCTGAGCGGCTTCGACCTGTCAACCAGTTCGGCTGCAGCACGGAAGACCATGGGCTACTGTCCGCAGTTCGACGCGCTGCACGACCTGCT
GACTGTGAAGGAGCAACTGCAGCTGTACGCCCGGATCAAGGGCATCCCCGAGGCTTTCGTGAACACCGCAGTGGAGGAGCAGATTCAGGAGTTGGGCCTC
ACGAAGTACCGCGACAAGCTCACGCGGGGTCTTAGTGGCGGCAACAAGCGCAAGGTTTCGACGGCCATCGCATTGTTGGGCCGTCCTCGTGTCGTATTCC
TTGATGAACCATCGACAGGCGTGGACCCAAGCTCACGACGGAAGATGTGGGACGTTATCGCGCGTGTGTGTTCTACCGATCGGGAAGGAGATCGCGGCGG
TGGAGCTTGTGTGGTGCTCACTACCCACTCGATGGAGGAGTGCGAGGCGCTGTGCTCTCGGGTGGGCATTCTCGTGAGTGGCCGGTTGAAATGCCTTGGC
AGCGTCGAGCACCTGAAGCAGAAGTTTGGTCGAGGATTCACGGTGGAGATCACGCTACGTGCGGCTTCAACTAATCCAGATGATGCGGAGCTGACTGCTA
TTATGGACCAAATGGTGGCCTTCCTCTCAGCCGAGAGGAGTCTCTCAGCGCATCGAAACAGCCGAACCAGCCAGCGCCAGAGCCTGACTCAGGGAGCAAA
GATCACAAGCGCCAACATCCAAGACTTGTGCACGGCGCTAGGCTCGTCTGAACGCGGCTCTCGCATTTTGGACCACTCGGGCACTGGCTGGTTGCTCAGC
AGTCAGCTTGAAGCTCAGGGTGCGATCTCGGTCGACAGTTTCTGCTCGTGGTGGGTCTCGGAGACGCACAGCGAGCGGCTGCAGAGCTTCTTCCACGACA
CGTTCCCGGGCAGCGTCCTCGCGGAGCAGCAGGGCGAGCACTTCCGCTTCCAAGTGCCCAAGCATCGACCAAGTAGCGACGCACTGCTGCGTCCGGCCGA
AATATTCCGTGCGCTCGAACATACGCGCGCGGATTTGAACGTGGACGAGTACAGCGTGAGTGAGACGGCGCTGGAACACATTTTCAATAACATGGCAGCG
CAGCAGGACGAGGAGAAGGGCGTCGCGCACGGAATGCACATGGAGTAAGCA