Description :
From Genome Similarity Track
Location :
contig_23:730663- 733095
Transcript NameFunction/comments
g5236.t1hypothetical protein

Sequence
2432 bases(100 bases per row)
GCCTCTGCTGCTGCAATCATGTGGGCGCTGCTTTGCCGCTGACCTTACTGTGGCTGAATTCGCCGTAAATCAGTACAAGCACACACACACACACGCACAC
ACACATGCAATTACTGGATTAGCAAAGTTCGTGGCCGACCTCATCCTCTCCCCCGCTCGCATAAGCCTAGCACCGTGCTCTCGCCCCAGCTGCTGCCACA
CATCATCTGCCTTCGAGAGGAATTGAACCTCTATCTCCGCGAGCGGAGCTTTCCCATTAAGCTACGAAGGAGCGCAAGAGCGGTGACATCAGCTGGGTGC
GATCAGCTGTCGTCGAGTGAAGGTGTCGGTCCTGGCAGTCTTGGCGTTGTCTGCGTGACCTGAGCGTCGCTCTCGTCCTCAGCTTCCTTTCGCTCCAGCT
TATTCTTGAATGAGTGAGAGTAGAGGCTCTCGTCCATGAAATGAAGTGTCACCTTCTGATTGGATGATGATATTAGGATCGGGTACGTTTTATGGGTGTC
TCCGCTCCACTTTATGAAAGTCCGATTTACTTCGCAAGTACCGATGTCGCCCGTGCGTTGGCTCGGCAAAAAAGTCAGAAAAGCACAATACCTAAAGTTG
CAGAATACTAGATTTTTAAAAGGCGCGAATCGTTGCTATGGAACTAGCCGGTTACACGACGGTTTAGAGTAGTGGAGGAGCGCTGAGCACTTCCTCCATA
TCGTTTTGATCGTTACAATCGTCTTCGACAAGCTCTTACGGAAGAGGTACTGCACGCCATGCGCATCTGATTGGGTAACATAAATGTACAGTGCTTCCGC
TATCCGTTGAAAGTCGAATTGTTGGAGAGTGATGTCTAAGTTACTGGCTGTGGGAGCTCGTCAGTTCAGCCGTTGTTTTCCAGCTCGACACGCTGCACCT
GCCACAATCATCCCCTCACTTCGTAAACTGCCCTGTATTGACCCTATAACCAATTTAGACGATTCAAACCGCCGCGCCATCGTCAACGTCGTTCTGCTTC
AAGCGGTAGGTGGTAATGTACATCGCGTCCGATATGGTGTTGTTTTCGAGCTATTACTCGTGTTTGGGACTGTTTTAAGGTGACGGTGGCCGACGGAGTC
GTAGAAGGCGACGTTTCCAGCAGAATCAAAAGGAAATTCGGGCCGTCGAGGGCATGACAGGGATGAATTAGTTACCAAGATCAAGGCAGTCCTGTTACAA
GAGCGGTCGGGCGATGACCACAACGGCGAAGGCTGTTGGGGTCTGTACGGGCGTTCTATAGCGCTCCTGCGCGAAAAAGTGGTGCACCGCATCACGTCGA
GGATCAAACCCGCCTTGACACCACAGAACATGGCCGCCCGAGTTGAGTATGCGCTGTTGTTTATCGACGAAAGGAGGTTCGTTTGTCGAGTCCATGTACG
ATATAGTACACGTGGACGAGATGTGGTTCTACGAGGATGTGAACAAACAATCGTACTACATCGTAGCAGACGAAAAAGCGCCTCCGTGCCGCCATAACAG
GAAGCGGTTCATACCCAGGACAATGTTTATCGCGGCAGTGGTCAAGTCCAGGTAACCTGACAAATGTTTACTTATGTACGTGCCATTACCATATTTGTTC
CGTATATTATACAGATATGATTACCATACAAAGTCCAGGTTTGACGGCAAGATCGGAATCTGGCCGTTCACGGTGGACTATGTTGCACAATGCTCAAGTG
TGAACCGTGTCAAGGGAGACCCCGTCACCAATAATATCGATTTCATCAACAGGAACATCTACATGGACTATCTCATTGGAAAAGTCAGCCCCGCCATCAA
GGCTAAGTATAGGGGTGAGAAGTGGGAGGTGATTTTCATCCAACAGGACAACGCAAGACTGCACCTTTCGCCGTTTGGTCCTGGCGTTGTTGCTGCCGGT
ACGTCCCTAAGCTGATACATCTGACTGCCCTTCCAGCCGCTGAATTCGCCCGATTTCAACGTGATTGATCTTGGGTCGAGACTCTAGATAATGTGTTCTT
GTTGTTGCAGGTAGTCATGATATGTGCCATTGTGAGTAATGGAGGAAACGAGTACAAGCTTCCCCACTACAATATAGCGCGGCTCAGGAGAGGACACAAG
CTACCTGAGTCGCTGCTGGGATGAAGCGACTTACCAGTTGCTGGAATTGAGCGATCAAGATGGAGACTGATGGCATGAGATCACGTGTTGAGGGATCATG
ACGGAAGAATTTCGGTTATATCCGGTTATGTCCAGTTGCGTTCAGAAGACATTCACCGCCGGCCCGAAGTGGATACATGTCGATCTGATGAGTATGGCGG
AATCATCTATGTCGGCCTGATCAGATCCATGTGGGCGATCATTTCGATACGCGAACTGATCCAGGTCAACGTGGCATCATCATTTCGACACGGGCGATCA
CATTGATTGTGGGTATAATGGAGCGATCGTTT