Description :
From Genome Similarity Track
Location :
contig_12:730583- 731599
Transcript NameFunction/comments
g3907.t1KUF82670.1 hypothetical protein AM587_10006930 [Phytophthora nicotianae

Sequence
1016 bases(100 bases per row)
GAGGAATGGTCCTTGAACAAGACGAGTTGGTATTTCAACGGCAAGATGTACCAGAAGTACGCGTCGCTGTGCCTCTTGGCCGCGGACGCTGCTGTCGTGG
GGAAAGATAAAAAGCTGCTCAAGACTTGCCTCACCAAGCTGGAGACGCTCATCGAGCCCTTCCTGAACAACACGCTCGCACCTGCTCTCAACTATGAGAC
GTCGTACGGTGGTCTCGTGAGCAGCCTGGGGTTCACCGTGAACGACGTGAACGCCGACTTTGGCAACACCGTGTACAACGACCACCACTACCACTACGGC
TACTGGGTGGCGGCTTCTGCCATGCTCAAGAGCCTCGACCCCAAGTGGGCGCGCATGAAAGACCTCGACTCGATGATCTGGATGATGCTGCGCGACGTGG
CCAACCCGAGCTCCGAAGACGCCTTCTTCCCCAAGTTCCGCCACTTCTCCTTCTACCTCGGCCATTCGTACTCGCACGGCGTGACTCCGATGCTTGATGG
CAAGGACGAAGAGAGCACGTCCGAAGACGTCAACTTCTACTACGGCATGAAGCTCTGGGGCCAAGTGTCCAAGAACAAGGCCGTGGAAGACCTCGGAAGC
CTCATGCTGCGCCTCAACGCGCGCGCCATCCGCACCTACTTCCTCATGACGTCGGACAACACCATCCACCCCAAGCAGTTCGTACCCAACCACGTGACGG
GCATCTTCTTCGACAACAAGGCGGCGTACGCGACGTGGTTCAGTGCCGAGAAGTACGCCATCCACGGCATCCAAATGATCCCCGTGTCCCCCATCAACGC
CATGGTGCGTACTACCAAGTTCATCCAGCAGGAGTGGGAAGACATTCTGTCCAAGGAGCCCATCGTCACCGAGGCCAACACGACGAACGCTTGGCTCTCG
CTCCTTCTAGTGAACGAGGCCGCTGTGGACCAGGAAGACGCACTGACCAAGCTCCAAGACGCCACCATGGACGACGGGCTCACCCGCTCGTGGGCATTGT
ACAATGCCGCCTCGCG