Description :
From Genome Similarity Track
Location :
Scaffold_101:7305- 9259
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_101-snap-gene-0.14Adenylate kinase domain-containing protein 1

Sequence
1954 bases(100 bases per row)
CGCGCACGGCCCGCGCACCCTTGATGCCCGAACCGCAGGACGTGGTGGCGCTGCTGGGCGAGAGCAAACGCTTGAGCTGTTCACTGACGCGGCAGTCGCG
CTCAAAGGCCGCGCGTTGGTCGGCGTACCGCTGGCGAATGTGGTCGGGAAGCACACTGCTGCTGGCACGTGTCTTGAGCAGCAGCGCAACGTACATGCAG
GCCGATGCCGTGATCGATACTCCGAGAAACTTGGGCCGCGCGGCACCCAGCAAGAGCAGCGTTTCGTTGAGCACACCCGAGAGCTCCTGCTCGATGCGGC
CGGGGCAGTGTTTGAGCGCGAGCGAGCTCGAGAGCTGCGGCGGCAGCTTGATAGGCAGCACTTGGCTCGCGTACTTGGTCGGCTGCGTAATGAATGCGCG
GCGCTTGAGCTCGGAGAGACAGAAGAAGACTTTGTTCTCGTACGACACGCGGTAGAAGACGGAGCCCTTGACGATCGCGTGCCAGTCCTTGTCGCCCGTG
CCCTGCTGGAACGTCACGGGGCAGTACCCTTTCATCTCGGGGAACTCGCAGTCGGCGACGCAGAGTAGTGAGAGCAGCGACGCGTCCACGGGCACCCTGG
CGATCAGTGCTGCGGCCTGGGCGGTGGCTTCCGCTGTGAAGAAGCGAGCGGGGCACGAGATAAAGTCGACGGCATTTGCCTCGTTGGCGAGCCACACGAC
CACGCGGCGGTCGGTCTCGTCCACGCACTCGACACACCAGTCTCTGTGGTGAGCAAGCGATGAATGGTATCGTCCCGAGGCGAGCTCCACGGGGCAAAAC
CACTGGTACGTGTCATGAGCCGCCGCCTCGAGAGCCGCTTGCGGGCGCACCACGCCCAGTAGCCGCACGGCTTGACCCATGGAGACGCCCGCCGTGTACA
CTCGAGCGGCTGCGCGCAGCTGCTGGAGCACGGCGCTTGCGGACGCGTGGACTTGCCACGCCGAGCTCGTGTCGGTGTCGAACTGGCGCATGTGGAACGC
GCCAAATGTCCGCGTCCATGTGTGGACGAGCTCGAGGCGGTGCGTGTGCCAGGCGACAAACCCCTCCGTGAGACGCTCGCGGTCGGTCGGGTCTGTGGAC
GTCCACACTCGATGGACCGAGCCTTCGAGGGCAAAGACGACGCCAGGATGAATGCGCTGCGTCCCGTATAGACAGCGAACGAGCTGGTCGGACGTGGTAA
CGTAGTCGTCAAGCACCCAGCCATGGCGCTGGCAGTCGGACGAGCAGAGCCGCGTGTGGATCGCGTCGTGGACAAGCGCTGGCGGGAGCTTCTGCCAGTC
GCTAGAAGGCGTGGCCTGCAGTGCGGACCAGAGCGACGACTGCGGGGCGAGGCACTGCCGTACCCAGTCGATTGCTGTGCGTGGGGACACGTAGACGAGT
CCAGATTGCCTGGCGACTTGCTTCGCTAGTCGAGTCTTGCCCACACGCGGCGGCCCTACGACGCAGCACGAGACGCGACACTGCGGAGGCTGGGACGACG
CCTCGGTAAGTGACAGGGCTGGCGCCAGTTCGCATTGCAAGAGCGCGGACGGCGATTGTGGGAAGTAGAGTCTTCTGCGATACGCCAGCGCCGGCCCAGC
AGAGAGCGAGGGGACGTCTCCAGTGATGGGGCATTGCATGGCGTGCTTTCCTACCACCGCGTCACCGGCATGAAGCCAATTGGACACGTCCACGGCCTGG
ACGCGTTCGCAGTACTCGAAGAGGGAGTACTTCTGGCCCAGCAGCGTCGTGATCGACTCGGCGAGGCGCTTGGCCACGGCGCGTCGTGTTGCGTTCATGT
CCAGCGCTGTCGCCACCGTGATGCCTCGCGCTCGCAGCGTCTCGAGCGCGAGCGTCTGTGCCTCCTGGTCTGCCTGGAACTGCTCTCGTAAGTGCACGCT
CTCGGCAGCCTCTTGCTCTGCTGGGTCGATCTGTTGAGCTTCTTCTGCATCGTC