Description :
From Genome Similarity Track
Location :
Scaffold_144:73015- 75455
Transcript NameFunction/comments
g18450.t1hypothetical protein

Sequence
2440 bases(100 bases per row)
TTAGGCTGCGAGTGGACAGGAGAGCTCCACGGTCTCACTCGTGCGTAGGATTCACCAATTGACCGGGGAATAGTACGAATCTCCCATTGTAAAGGCTGAA
GAGGCTACTGCGAGAGCCCCACGCGTATGTTCTCTAGATGGTGGGAGGGACAGTTTCCAGCAATTGGAAAAACAAACTTTTAAGAAGGAGGAACTAGGAG
AGAAACAAAAAAGGCGAAGCTGAGCCACCAATTCCATAATTCATGTTGAGACTTGGTAGAGGTAGATACTGTCAAAGTCTTGAGCGTCGTCTACATGGAC
GAGTTGACTTTTGTCGACCGATTTAGCAGACAACCCCCAACGAGAAAGTAGCGGCGCGATTGATCGGTTGATACTTCGCAGTTGGTACGACAAGTAGAAC
TGGCAGGACGTGCAATTGCTGCAGCGGAAGATGAGAGCGACGGTGGCCAGCACCTTCTCGAAATCTGCAAGTTGAGGGAGTTAGATGTGGTTTTACAGTT
GATTCTGTTGCGATTGTACCTTCAGACTGGTAGAAGCAGTCGGCGGCGAGGATGACTTGGACGCTTCGGAAGATGGCGAGCACTTTGTCCGGTACGAGCA
TGTCGCCCCAGGTGAGTCCAATGAACTGGGCACGATCCTCGAGACCGTTTAGCTTGATGTTGACTTCTGCGTTGCGCTGGACGTCGACAGCGTCGGGTCG
ATCGGTAAGATACACCTTCGTCGCGCCACACAACCCAGCGAGGATCGACGGGAGGCCAGTGCCGCAGCCCAATTCCAGCACAACTTTGTCGCGACACAGC
GAGTCGACTTCGCGGGCGACAAATCGCGACAGCAAAAGTGCGGACGGCCACACAAACAGCCCGTAGTGCTTGTCATTGTCTTCGTTGGCCTCGTCGAGGT
CACGGATAAGCTCGACAAGCCGCACGTCGACGATGGAAGTCTCACCAAGGCGTCGCCGCTTCAACTTCGGCTCTACAGCCGTCACCGCACCTTGAACTTT
ATCCAACGGCACTGCTAACGCCGCGTCATCACCACACGACCCACAGACGAAGCTGAGCGTGCGTTGCGACGCAGCATCAGCGCTCAAGGCCTCCATGCTG
CTGCACCAGTCACGAAAACGGGACGGAAGCGATGAGCTACCCGTAAACTACTGTCGACGAACAGATCCACTTCAACTTGGGAAAAGGATCTTGAAGCGGA
TTCACCAATGCCGGCAACGCGACGGTTGGAACTGACGGCTTTCGACCCGCAGGAGCAGTATTGACACCAAACTCGAAGGAAAACGGACTTGGACATGCAG
CAAGACGAGGTTGACCAAGCTCTCGACGCCACCATCTTGCTGCCTGATGAAGAAGCCTCGCTGTCGAAGCAGATCATCACGAACTACTTCACTAGCGACG
GACCACGAGCAAGGAGGCTGGGTTCCAGCGACCTCGAGCCGGAGAGAAGCATTTTGGATGAAAGCAGCGGAGACGAAGAACTTCGACATTCTGGGAAGAT
GCCAGCCGAAGTACTACATGAAACGGAGAGAGAGCCATCGGAAGTATACGAAAGGGAGACCGTGAACGCTGGAGTTGATGACCGCGAGGAAAGAGCGATG
GGGATGCTCGAAGAAATACTGACCTGGGAAATCGCGCTGTCAGTGGTAGTCGTGATTTTGGCCCTGGCGCACTGCGTGTGGATGTGGAACTTGGTGGAGC
TCAGCACTTTGAATTTGGAGTTTGGAGACTAGAAAGTGTGCGCAACGAATACAGTTGGAGATTTCAGCATGCTATGATGAACATGCTACTGATCTGTCTG
TTGAATGTGTGCACTACCTTGCGCTGTGGAGGACTATAGCTGCAGACAAGCTTCGATCTGTTGCTGCATCCGTGTTACGTGTTGACAAGAGAGGTCTCCA
GCACCTTCTAGGCCTGGGGTGGCACACGCTGCCTCGTGGAGCAAGGTTAGCTGACTTGCATCGAGCGTTCTCAGCACCTCTTGAAACAGGGCGTCTTGAT
TAGCCACTCCGTTGGGCTCTTGCATCTCGCCGACTGGCGACGGTTGCTGAATTTCCTCCTCCTCGTCCCAGTTGTCCCAGGATTCAAGTGCTGAATTTTG
CTTTCCATTAACACCAGATACGGTGAGGGCCTGCTGTCGCTGGCTGTAAAGACTGGCAATTGCAACCAGTAGCTTCTCCTTGCTGCGGTTGCCGCTAGTA
GTGCATGACAGCCACATTTGCAGATAAATATCCAGCAAGTTGGCGTACGTTGCGTCTTTGATTTTGGTCTGCGGAGCACCAAAGGTGTCACTGAGGCACT
GAACAATTTTGTCGAACTCTTCATATAGTTGGTGAGAGTTCGGGGAATGAAGTAGCATGCTAAGACTTTCTAAGAGGCTGGATTGAGCCTCTGACTTGTT
CATCGTGATCCAGCGAAACATGTCGTTGCACAATAGCCAC