Description :
From Genome Similarity Track
Location :
Scaffold_20:73011- 74390
Transcript NameFunction/comments
g8170.t1RAW25222.1 hypothetical protein PC110_g18355 [Phytophthora cactorum
g8171.t1hypothetical protein

Sequence
1379 bases(100 bases per row)
AACTCCACGAGCGCGTCCCGCGTCGGCAGGGTGGCGTCATACTCTGTGCGGTCGTTCGGGTTGGACAGGATGGCGTAGGCCGCCGGCACGCCCTCCCAGC
GAGCCAGCGCCTCTGGCGACGGTTTCCTGTCCGGGTGGCACTTGAGCGCCAGCTTGCGATAAGTCTTGCGAATCTGTCAGCGCAACAGGTTCTCCGTTAG
TTCAGCTACACACTCGACTCTTCTACTATCCGCGGTTCACTGACCTCCGTGTGGGTGGCGTCGCGAGGGAGGCCCAGCAGCTCGTAGTGGTCCTTGTATC
GCATTCCCTGCGTCTCCAGGTCGCTCGACTGCATCTTGTACTTCTTCATGTACTCACGGTGCTGCTCCATGTCCTTCTCCGACAGCTTACTGCCGCTCTT
GGACTTGCTCATGATCGTTCTCTGCTTCCGTCCCCCGCTAGTGACGGCACCGGTTGCGATGACAGCGAAGCTTTCCTCGACTTCTTTCCCTCTGCTTGCA
CTTCGGCGTCTGCCCACTGCGGGCAGGGGTTCACCAGCTGGCTCGTTACTAGCCTTTTCAACCAATCATAGGTATCATTACTCGCCAACCAGCGAGTATC
AAAATGAAAAGCCAAATATCAAGGCAACCATGATGGCAATCACCTCCGAGTAGCTGCGCTGCGCTGTGAGCGCTTCAGGCCACATGCCCATAGAAGCACC
TCGCCCGAACGTACATGATCCAAGTACGTAGTCGAATGCATCAACCATCCTTCCAAACCATTTTTCGAGTTGCATGCGCAGGTAATGCGTTCCAGATGCG
CCTTGTCCAGAAACTGCCAAGGTATTATAGTCTCCACTGGCTCCGCTGCGGAACTCACTCTTCGGTCCAGCAGACGACCTGCGCTGAAGCAGCATACAAT
AGCGTGGTGCCGGGTCGAGCTCTTGGCGCGAATCACCGTCACAGCACAGCATGCTCTCCTTAGACTCATGTCGACACTTTACTAGCTACTCGCGCACGTA
GTACACTTGCAGGTTGCACACTCTTGCGGCGTGAGCGCTTAAAATCTCTTTTAACAGCGGAAAAAGGCTTGTCAAGTCAAACTTGCTCCGTGTCATCAAG
ACGCTCGTCAAACGTGCAGATACGGTACGCACCGATATCAAATGTACGGATATACTACGGACCGTGAAATAACATATTAAATGCCAGTCGACAGGGAAAT
ACTGTGATTGGCCAAAAGTTGGCTTATGTGAACGCACACGAATCGCTGCAGTGTGTGGCCTCCAGCATTTTGCTTGTCGACCCCCTGCATCATGATTTCG
TGCGTGAGGCTCTCCTCCGCCGTCAAGAGCGGCTCTGTCGCTCGAGCAGTAAGCCGCTGTGCACCTGCATCTACTAGTA